Incidental Mutation 'R4374:Scamp3'
ID325021
Institutional Source Beutler Lab
Gene Symbol Scamp3
Ensembl Gene ENSMUSG00000028049
Gene Namesecretory carrier membrane protein 3
SynonymsSc3
MMRRC Submission 041118-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.898) question?
Stock #R4374 (G1)
Quality Score160
Status Validated
Chromosome3
Chromosomal Location89177473-89182765 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 89181927 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029684] [ENSMUST00000041913] [ENSMUST00000098941] [ENSMUST00000117278] [ENSMUST00000119707] [ENSMUST00000120697] [ENSMUST00000127982] [ENSMUST00000140473] [ENSMUST00000147696]
Predicted Effect probably damaging
Transcript: ENSMUST00000029684
AA Change: G263S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029684
Gene: ENSMUSG00000028049
AA Change: G263S

DomainStartEndE-ValueType
low complexity region 49 69 N/A INTRINSIC
coiled coil region 89 127 N/A INTRINSIC
Pfam:SCAMP 133 310 1.5e-76 PFAM
low complexity region 329 348 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000041913
SMART Domains Protein: ENSMUSP00000039261
Gene: ENSMUSG00000032657

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:CD20 36 196 8e-36 PFAM
low complexity region 243 254 N/A INTRINSIC
low complexity region 390 408 N/A INTRINSIC
low complexity region 445 463 N/A INTRINSIC
low complexity region 471 490 N/A INTRINSIC
low complexity region 628 649 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098941
AA Change: G229S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096540
Gene: ENSMUSG00000028049
AA Change: G229S

DomainStartEndE-ValueType
low complexity region 49 69 N/A INTRINSIC
coiled coil region 89 127 N/A INTRINSIC
Pfam:SCAMP 133 229 5.5e-46 PFAM
Pfam:SCAMP 227 276 2.2e-11 PFAM
low complexity region 295 314 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117278
SMART Domains Protein: ENSMUSP00000113706
Gene: ENSMUSG00000032657

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
transmembrane domain 34 56 N/A INTRINSIC
Pfam:CD20 74 177 7.3e-13 PFAM
low complexity region 224 235 N/A INTRINSIC
low complexity region 371 389 N/A INTRINSIC
low complexity region 426 444 N/A INTRINSIC
low complexity region 452 471 N/A INTRINSIC
low complexity region 609 630 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119707
SMART Domains Protein: ENSMUSP00000113579
Gene: ENSMUSG00000032657

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:CD20 36 196 1.9e-18 PFAM
low complexity region 312 330 N/A INTRINSIC
low complexity region 367 385 N/A INTRINSIC
low complexity region 393 412 N/A INTRINSIC
low complexity region 550 571 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120697
AA Change: G264S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112846
Gene: ENSMUSG00000028049
AA Change: G264S

DomainStartEndE-ValueType
low complexity region 50 70 N/A INTRINSIC
coiled coil region 90 128 N/A INTRINSIC
Pfam:SCAMP 135 310 1.1e-67 PFAM
low complexity region 330 349 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126115
Predicted Effect probably benign
Transcript: ENSMUST00000127982
SMART Domains Protein: ENSMUSP00000114855
Gene: ENSMUSG00000032657

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:CD20 36 77 6.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136165
Predicted Effect probably null
Transcript: ENSMUST00000140473
Predicted Effect probably benign
Transcript: ENSMUST00000147696
SMART Domains Protein: ENSMUSP00000117185
Gene: ENSMUSG00000032657

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:CD20 36 196 1.9e-30 PFAM
low complexity region 242 253 N/A INTRINSIC
low complexity region 324 349 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156447
Meta Mutation Damage Score 0.9097 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that belongs to the secretory carrier membrane protein family. The encoded protein functions as a carrier to the cell surface in post-golgi recycling pathways. This protein is also involved in protein trafficking in endosomal pathways. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Abhd2 A G 7: 79,323,530 M86V probably benign Het
Acin1 C A 14: 54,653,894 probably benign Het
Aebp2 T A 6: 140,654,258 probably benign Het
Akap13 A G 7: 75,608,984 E452G probably damaging Het
Amz1 T C 5: 140,752,439 S184P possibly damaging Het
Ccdc83 A T 7: 90,226,778 L295* probably null Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cpsf7 A T 19: 10,539,637 I368F probably damaging Het
Csf1r G A 18: 61,119,006 C520Y probably damaging Het
Dapk1 A G 13: 60,719,684 D235G probably benign Het
Ercc1 G A 7: 19,347,132 probably benign Het
Fktn T C 4: 53,720,201 S72P probably damaging Het
Frem2 C A 3: 53,545,502 V2189F possibly damaging Het
Gm10845 G T 14: 79,863,123 noncoding transcript Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Lama1 A G 17: 67,804,518 M2255V probably benign Het
Lrsam1 G T 2: 32,955,191 T104K possibly damaging Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Myo7a G A 7: 98,102,674 T54M probably damaging Het
Olfr178 A C 16: 58,889,879 C114G probably benign Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pfkp A G 13: 6,620,989 S135P probably damaging Het
Phf20l1 C T 15: 66,604,837 T260I possibly damaging Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Ppp6r2 T G 15: 89,265,158 C216W probably damaging Het
Pramel7 C T 2: 87,490,071 A293T probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Setbp1 T C 18: 78,859,922 R177G probably damaging Het
Sh2b3 G T 5: 121,828,486 probably benign Het
Tbc1d30 A G 10: 121,294,712 F271S probably damaging Het
Tpo T C 12: 30,103,152 E401G possibly damaging Het
Zdhhc13 T C 7: 48,808,841 Y308H probably damaging Het
Zfp112 C T 7: 24,126,373 H589Y probably damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Scamp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Scamp3 APN 3 89177666 unclassified probably benign
IGL01362:Scamp3 APN 3 89179134 missense probably benign 0.01
IGL02269:Scamp3 APN 3 89180734 missense probably benign 0.12
R0908:Scamp3 UTSW 3 89179439 unclassified probably null
R1160:Scamp3 UTSW 3 89181198 missense probably damaging 1.00
R1899:Scamp3 UTSW 3 89180260 missense probably damaging 1.00
R4237:Scamp3 UTSW 3 89181927 unclassified probably null
R4238:Scamp3 UTSW 3 89181927 unclassified probably null
R4373:Scamp3 UTSW 3 89181927 unclassified probably null
R5013:Scamp3 UTSW 3 89180909 unclassified probably benign
R5023:Scamp3 UTSW 3 89182293 unclassified probably benign
R5057:Scamp3 UTSW 3 89182293 unclassified probably benign
R5522:Scamp3 UTSW 3 89177622 missense possibly damaging 0.90
R5762:Scamp3 UTSW 3 89181197 missense probably damaging 1.00
R6788:Scamp3 UTSW 3 89181949 missense probably benign 0.00
R7586:Scamp3 UTSW 3 89180366 missense probably damaging 1.00
R7606:Scamp3 UTSW 3 89181218 missense probably damaging 1.00
R7769:Scamp3 UTSW 3 89177991 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCATGAGGATGCCAGGAGAG -3'
(R):5'- AATGTTCCACTCAGCAGCCC -3'

Sequencing Primer
(F):5'- CGGATGCTTCAGAAATGACTG -3'
(R):5'- CCCTAGGGACCCAATGATCTC -3'
Posted On2015-07-06