Incidental Mutation 'R4374:Rpl11'
ID325024
Institutional Source Beutler Lab
Gene Symbol Rpl11
Ensembl Gene ENSMUSG00000059291
Gene Nameribosomal protein L11
Synonyms
MMRRC Submission 041118-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.925) question?
Stock #R4374 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location136028265-136053428 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 136051143 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102536] [ENSMUST00000155873]
Predicted Effect probably benign
Transcript: ENSMUST00000102536
SMART Domains Protein: ENSMUSP00000099595
Gene: ENSMUSG00000059291

DomainStartEndE-ValueType
Pfam:Ribosomal_L5 10 63 6.9e-23 PFAM
Pfam:Ribosomal_L5_C 67 166 9.5e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142440
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150565
Predicted Effect probably benign
Transcript: ENSMUST00000155873
SMART Domains Protein: ENSMUSP00000121108
Gene: ENSMUSG00000059291

DomainStartEndE-ValueType
Pfam:Ribosomal_L5 13 66 8e-23 PFAM
Pfam:Ribosomal_L5_C 70 169 1.1e-26 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L5P family of ribosomal proteins. It is located in the cytoplasm. The protein probably associates with the 5S rRNA. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Abhd2 A G 7: 79,323,530 M86V probably benign Het
Acin1 C A 14: 54,653,894 probably benign Het
Aebp2 T A 6: 140,654,258 probably benign Het
Akap13 A G 7: 75,608,984 E452G probably damaging Het
Amz1 T C 5: 140,752,439 S184P possibly damaging Het
Ccdc83 A T 7: 90,226,778 L295* probably null Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cpsf7 A T 19: 10,539,637 I368F probably damaging Het
Csf1r G A 18: 61,119,006 C520Y probably damaging Het
Dapk1 A G 13: 60,719,684 D235G probably benign Het
Ercc1 G A 7: 19,347,132 probably benign Het
Fktn T C 4: 53,720,201 S72P probably damaging Het
Frem2 C A 3: 53,545,502 V2189F possibly damaging Het
Gm10845 G T 14: 79,863,123 noncoding transcript Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Lama1 A G 17: 67,804,518 M2255V probably benign Het
Lrsam1 G T 2: 32,955,191 T104K possibly damaging Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Myo7a G A 7: 98,102,674 T54M probably damaging Het
Olfr178 A C 16: 58,889,879 C114G probably benign Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pfkp A G 13: 6,620,989 S135P probably damaging Het
Phf20l1 C T 15: 66,604,837 T260I possibly damaging Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Ppp6r2 T G 15: 89,265,158 C216W probably damaging Het
Pramel7 C T 2: 87,490,071 A293T probably benign Het
Scamp3 G A 3: 89,181,927 probably null Het
Setbp1 T C 18: 78,859,922 R177G probably damaging Het
Sh2b3 G T 5: 121,828,486 probably benign Het
Tbc1d30 A G 10: 121,294,712 F271S probably damaging Het
Tpo T C 12: 30,103,152 E401G possibly damaging Het
Zdhhc13 T C 7: 48,808,841 Y308H probably damaging Het
Zfp112 C T 7: 24,126,373 H589Y probably damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Rpl11
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4373:Rpl11 UTSW 4 136051143 intron probably benign
R4375:Rpl11 UTSW 4 136051143 intron probably benign
R4377:Rpl11 UTSW 4 136051143 intron probably benign
R4560:Rpl11 UTSW 4 136051211 missense probably damaging 1.00
R4781:Rpl11 UTSW 4 136050288 missense probably benign 0.00
R5541:Rpl11 UTSW 4 136052732 splice site probably benign
Predicted Primers PCR Primer
(F):5'- AGGATGACCCAGAGAGCTTTG -3'
(R):5'- GCTCATGTTGGGCTACTTGAAC -3'

Sequencing Primer
(F):5'- GACCCAGAGAGCTTTGCAACG -3'
(R):5'- CATGATGGATAGCATGGTCACTTC -3'
Posted On2015-07-06