Incidental Mutation 'R4374:Abhd2'
ID325031
Institutional Source Beutler Lab
Gene Symbol Abhd2
Ensembl Gene ENSMUSG00000039202
Gene Nameabhydrolase domain containing 2
SynonymsLABH2, 2210009N18Rik
MMRRC Submission 041118-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.347) question?
Stock #R4374 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location79273199-79365508 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79323530 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 86 (M86V)
Ref Sequence ENSEMBL: ENSMUSP00000038361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037315]
Predicted Effect probably benign
Transcript: ENSMUST00000037315
AA Change: M86V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000038361
Gene: ENSMUSG00000039202
AA Change: M86V

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
Pfam:Hydrolase_4 124 362 1.1e-10 PFAM
Pfam:Abhydrolase_1 126 383 2.3e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135333
Meta Mutation Damage Score 0.0595 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing an alpha/beta hydrolase fold, which is a catalytic domain found in a wide range of enzymes. The encoded protein is an acylglycerol lipase that catalyzes the hydrolysis of endocannabinoid arachidonoylglycerol from the cell membrane. This leads to activation of the sperm calcium channel CatSper, which results in sperm activation. Alternative splicing of this gene results in two transcript variants encoding the same protein. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a gene trapped allele are overtly but exhibit enhanced migratory ability of cultured smooth muscle cells, and significant intimal hyperplasia after cuff placement. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Acin1 C A 14: 54,653,894 probably benign Het
Aebp2 T A 6: 140,654,258 probably benign Het
Akap13 A G 7: 75,608,984 E452G probably damaging Het
Amz1 T C 5: 140,752,439 S184P possibly damaging Het
Ccdc83 A T 7: 90,226,778 L295* probably null Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cpsf7 A T 19: 10,539,637 I368F probably damaging Het
Csf1r G A 18: 61,119,006 C520Y probably damaging Het
Dapk1 A G 13: 60,719,684 D235G probably benign Het
Ercc1 G A 7: 19,347,132 probably benign Het
Fktn T C 4: 53,720,201 S72P probably damaging Het
Frem2 C A 3: 53,545,502 V2189F possibly damaging Het
Gm10845 G T 14: 79,863,123 noncoding transcript Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Lama1 A G 17: 67,804,518 M2255V probably benign Het
Lrsam1 G T 2: 32,955,191 T104K possibly damaging Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Myo7a G A 7: 98,102,674 T54M probably damaging Het
Olfr178 A C 16: 58,889,879 C114G probably benign Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pfkp A G 13: 6,620,989 S135P probably damaging Het
Phf20l1 C T 15: 66,604,837 T260I possibly damaging Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Ppp6r2 T G 15: 89,265,158 C216W probably damaging Het
Pramel7 C T 2: 87,490,071 A293T probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Scamp3 G A 3: 89,181,927 probably null Het
Setbp1 T C 18: 78,859,922 R177G probably damaging Het
Sh2b3 G T 5: 121,828,486 probably benign Het
Tbc1d30 A G 10: 121,294,712 F271S probably damaging Het
Tpo T C 12: 30,103,152 E401G possibly damaging Het
Zdhhc13 T C 7: 48,808,841 Y308H probably damaging Het
Zfp112 C T 7: 24,126,373 H589Y probably damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Abhd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Abhd2 APN 7 79325452 missense possibly damaging 0.91
IGL03067:Abhd2 APN 7 79360034 missense probably benign
R0363:Abhd2 UTSW 7 79350813 missense possibly damaging 0.81
R1587:Abhd2 UTSW 7 79354010 missense probably benign 0.01
R1921:Abhd2 UTSW 7 79348356 missense possibly damaging 0.83
R3108:Abhd2 UTSW 7 79323585 missense probably benign 0.01
R4621:Abhd2 UTSW 7 79325487 missense probably damaging 1.00
R4763:Abhd2 UTSW 7 79360131 missense probably benign 0.00
R5217:Abhd2 UTSW 7 79323630 missense probably benign
R5599:Abhd2 UTSW 7 79296998 splice site probably null
R6972:Abhd2 UTSW 7 79354027 missense probably benign 0.02
R7617:Abhd2 UTSW 7 79348284 missense probably benign 0.10
R8062:Abhd2 UTSW 7 79325590 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AGGAACCCATTGTGTTTATGGTTAG -3'
(R):5'- CTGGCCTCTGAACACAATGG -3'

Sequencing Primer
(F):5'- ATGGTTAGTGTGCAGAATAATGTG -3'
(R):5'- TGGGTGACACAGGCATTTCAC -3'
Posted On2015-07-06