Incidental Mutation 'R4374:Olfr608'
ID325034
Institutional Source Beutler Lab
Gene Symbol Olfr608
Ensembl Gene ENSMUSG00000073948
Gene Nameolfactory receptor 608
SynonymsGA_x6K02T2PBJ9-6191595-6192545, MOR26-3
MMRRC Submission 041118-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R4374 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103469877-103471358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103470071 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 11 (S11P)
Ref Sequence ENSEMBL: ENSMUSP00000150595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000213546]
Predicted Effect probably damaging
Transcript: ENSMUST00000098199
AA Change: S11P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095801
Gene: ENSMUSG00000073948
AA Change: S11P

DomainStartEndE-ValueType
Pfam:7tm_4 32 311 4.7e-101 PFAM
Pfam:7TM_GPCR_Srsx 36 308 7.1e-8 PFAM
Pfam:7tm_1 42 293 6.4e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213546
AA Change: S11P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Abhd2 A G 7: 79,323,530 M86V probably benign Het
Acin1 C A 14: 54,653,894 probably benign Het
Aebp2 T A 6: 140,654,258 probably benign Het
Akap13 A G 7: 75,608,984 E452G probably damaging Het
Amz1 T C 5: 140,752,439 S184P possibly damaging Het
Ccdc83 A T 7: 90,226,778 L295* probably null Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cpsf7 A T 19: 10,539,637 I368F probably damaging Het
Csf1r G A 18: 61,119,006 C520Y probably damaging Het
Dapk1 A G 13: 60,719,684 D235G probably benign Het
Ercc1 G A 7: 19,347,132 probably benign Het
Fktn T C 4: 53,720,201 S72P probably damaging Het
Frem2 C A 3: 53,545,502 V2189F possibly damaging Het
Gm10845 G T 14: 79,863,123 noncoding transcript Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Lama1 A G 17: 67,804,518 M2255V probably benign Het
Lrsam1 G T 2: 32,955,191 T104K possibly damaging Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Myo7a G A 7: 98,102,674 T54M probably damaging Het
Olfr178 A C 16: 58,889,879 C114G probably benign Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pfkp A G 13: 6,620,989 S135P probably damaging Het
Phf20l1 C T 15: 66,604,837 T260I possibly damaging Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Ppp6r2 T G 15: 89,265,158 C216W probably damaging Het
Pramel7 C T 2: 87,490,071 A293T probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Scamp3 G A 3: 89,181,927 probably null Het
Setbp1 T C 18: 78,859,922 R177G probably damaging Het
Sh2b3 G T 5: 121,828,486 probably benign Het
Tbc1d30 A G 10: 121,294,712 F271S probably damaging Het
Tpo T C 12: 30,103,152 E401G possibly damaging Het
Zdhhc13 T C 7: 48,808,841 Y308H probably damaging Het
Zfp112 C T 7: 24,126,373 H589Y probably damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Olfr608
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01735:Olfr608 APN 7 103470323 missense probably damaging 1.00
IGL02428:Olfr608 APN 7 103470383 missense probably benign 0.03
IGL02832:Olfr608 APN 7 103470698 missense probably benign 0.00
R0546:Olfr608 UTSW 7 103470700 missense possibly damaging 0.65
R1518:Olfr608 UTSW 7 103470042 start codon destroyed probably null 0.98
R1696:Olfr608 UTSW 7 103470177 missense probably benign 0.18
R1735:Olfr608 UTSW 7 103470146 missense possibly damaging 0.83
R2927:Olfr608 UTSW 7 103470882 missense probably damaging 1.00
R3856:Olfr608 UTSW 7 103470660 missense probably damaging 1.00
R4375:Olfr608 UTSW 7 103470071 missense probably damaging 0.97
R4377:Olfr608 UTSW 7 103470071 missense probably damaging 0.97
R5059:Olfr608 UTSW 7 103470281 nonsense probably null
R5174:Olfr608 UTSW 7 103470403 missense probably benign 0.14
R5579:Olfr608 UTSW 7 103470914 missense probably damaging 1.00
R6762:Olfr608 UTSW 7 103470389 missense probably benign 0.02
R7888:Olfr608 UTSW 7 103470799 nonsense probably null
R7971:Olfr608 UTSW 7 103470799 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGGATGACATTTTGGAAACCTAGG -3'
(R):5'- AAATACCAAGCATTTTCAGGGACG -3'

Sequencing Primer
(F):5'- TTTTGGAAACCTAGGCTAGAAATTC -3'
(R):5'- CATTTTCAGGGACGTGGAAC -3'
Posted On2015-07-06