Incidental Mutation 'R4374:Hk1'
ID325036
Institutional Source Beutler Lab
Gene Symbol Hk1
Ensembl Gene ENSMUSG00000037012
Gene Namehexokinase 1
SynonymsmHk1-s, Hk-1, Hk1-s
MMRRC Submission 041118-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.492) question?
Stock #R4374 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location62268855-62379908 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 62315540 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 10 (K10N)
Ref Sequence ENSEMBL: ENSMUSP00000118166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072357] [ENSMUST00000099691] [ENSMUST00000116238] [ENSMUST00000130091] [ENSMUST00000130422] [ENSMUST00000132926] [ENSMUST00000133429] [ENSMUST00000134447] [ENSMUST00000134877] [ENSMUST00000135317] [ENSMUST00000136548] [ENSMUST00000139228] [ENSMUST00000140383] [ENSMUST00000143179] [ENSMUST00000143236] [ENSMUST00000152761] [ENSMUST00000154489]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072357
AA Change: K28N

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000072195
Gene: ENSMUSG00000037012
AA Change: K28N

DomainStartEndE-ValueType
Pfam:Hexokinase_1 25 224 1.2e-70 PFAM
Pfam:Hexokinase_2 229 486 8e-79 PFAM
Pfam:Hexokinase_1 496 695 7e-76 PFAM
Pfam:Hexokinase_2 700 934 4.2e-85 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000099691
AA Change: K24N

PolyPhen 2 Score 0.628 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097282
Gene: ENSMUSG00000037012
AA Change: K24N

DomainStartEndE-ValueType
Pfam:Hexokinase_1 16 221 1.9e-86 PFAM
Pfam:Hexokinase_2 223 462 1e-102 PFAM
Pfam:Hexokinase_1 464 669 1.1e-90 PFAM
Pfam:Hexokinase_2 671 910 2.2e-109 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000116238
AA Change: K28N

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000111946
Gene: ENSMUSG00000037012
AA Change: K28N

DomainStartEndE-ValueType
Pfam:Hexokinase_1 21 225 1.3e-85 PFAM
Pfam:Hexokinase_2 227 357 3.6e-56 PFAM
Pfam:Hexokinase_2 362 489 9.3e-41 PFAM
Pfam:Hexokinase_1 491 696 2e-90 PFAM
Pfam:Hexokinase_2 698 937 3.8e-109 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000130091
AA Change: K28N

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000130422
AA Change: K23N

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000118601
Gene: ENSMUSG00000037012
AA Change: K23N

DomainStartEndE-ValueType
Pfam:Hexokinase_1 16 220 1.4e-85 PFAM
Pfam:Hexokinase_2 222 461 1e-102 PFAM
Pfam:Hexokinase_1 463 668 1.1e-90 PFAM
Pfam:Hexokinase_2 670 909 2.2e-109 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000132926
AA Change: K28N

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000133429
AA Change: K28N

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000134447
AA Change: K28N

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000134877
AA Change: K28N

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000135317
AA Change: K28N

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000136548
AA Change: K28N

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000139228
AA Change: K10N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118166
Gene: ENSMUSG00000037012
AA Change: K10N

DomainStartEndE-ValueType
Pfam:Hexokinase_1 3 184 1.4e-74 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000140383
AA Change: K28N

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142527
Predicted Effect probably benign
Transcript: ENSMUST00000143179
SMART Domains Protein: ENSMUSP00000120151
Gene: ENSMUSG00000037012

DomainStartEndE-ValueType
Pfam:Hexokinase_1 5 80 5e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000143236
AA Change: K28N

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect unknown
Transcript: ENSMUST00000149534
AA Change: K92N
Predicted Effect possibly damaging
Transcript: ENSMUST00000152761
AA Change: K8N

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117752
Gene: ENSMUSG00000037012
AA Change: K8N

DomainStartEndE-ValueType
Pfam:Hexokinase_1 2 205 5.6e-88 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000154489
AA Change: K28N

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1488 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes a ubiquitous form of hexokinase which localizes to the outer membrane of mitochondria. Mutations in this gene have been associated with hemolytic anemia due to hexokinase deficiency. Alternative splicing of this gene results in several transcript variants which encode different isoforms, some of which are tissue-specific. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous mutant mice exhibit hemolytic anemia with extensive tissue iron deposition and reticulocytosis and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Abhd2 A G 7: 79,323,530 M86V probably benign Het
Acin1 C A 14: 54,653,894 probably benign Het
Aebp2 T A 6: 140,654,258 probably benign Het
Akap13 A G 7: 75,608,984 E452G probably damaging Het
Amz1 T C 5: 140,752,439 S184P possibly damaging Het
Ccdc83 A T 7: 90,226,778 L295* probably null Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cpsf7 A T 19: 10,539,637 I368F probably damaging Het
Csf1r G A 18: 61,119,006 C520Y probably damaging Het
Dapk1 A G 13: 60,719,684 D235G probably benign Het
Ercc1 G A 7: 19,347,132 probably benign Het
Fktn T C 4: 53,720,201 S72P probably damaging Het
Frem2 C A 3: 53,545,502 V2189F possibly damaging Het
Gm10845 G T 14: 79,863,123 noncoding transcript Het
Lama1 A G 17: 67,804,518 M2255V probably benign Het
Lrsam1 G T 2: 32,955,191 T104K possibly damaging Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Myo7a G A 7: 98,102,674 T54M probably damaging Het
Olfr178 A C 16: 58,889,879 C114G probably benign Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pfkp A G 13: 6,620,989 S135P probably damaging Het
Phf20l1 C T 15: 66,604,837 T260I possibly damaging Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Ppp6r2 T G 15: 89,265,158 C216W probably damaging Het
Pramel7 C T 2: 87,490,071 A293T probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Scamp3 G A 3: 89,181,927 probably null Het
Setbp1 T C 18: 78,859,922 R177G probably damaging Het
Sh2b3 G T 5: 121,828,486 probably benign Het
Tbc1d30 A G 10: 121,294,712 F271S probably damaging Het
Tpo T C 12: 30,103,152 E401G possibly damaging Het
Zdhhc13 T C 7: 48,808,841 Y308H probably damaging Het
Zfp112 C T 7: 24,126,373 H589Y probably damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Hk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Hk1 APN 10 62286348 nonsense probably null
IGL01108:Hk1 APN 10 62296708 missense probably benign 0.00
IGL01810:Hk1 APN 10 62353105 missense probably benign 0.13
IGL01950:Hk1 APN 10 62315394 missense probably damaging 0.99
IGL02165:Hk1 APN 10 62281888 missense probably damaging 1.00
IGL02227:Hk1 APN 10 62281140 splice site probably benign
IGL02257:Hk1 APN 10 62271643 missense probably benign 0.07
IGL02341:Hk1 APN 10 62284380 missense possibly damaging 0.54
IGL02553:Hk1 APN 10 62295773 missense possibly damaging 0.71
IGL02623:Hk1 APN 10 62292359 missense probably benign 0.21
IGL02700:Hk1 APN 10 62284811 missense probably damaging 1.00
IGL02863:Hk1 APN 10 62295755 missense possibly damaging 0.83
IGL03002:Hk1 APN 10 62271799 missense probably damaging 1.00
R0029:Hk1 UTSW 10 62315394 missense probably damaging 0.99
R0436:Hk1 UTSW 10 62299275 splice site probably benign
R0853:Hk1 UTSW 10 62271716 nonsense probably null
R1422:Hk1 UTSW 10 62296094 missense probably null 0.98
R1531:Hk1 UTSW 10 62284784 missense probably damaging 1.00
R1760:Hk1 UTSW 10 62281899 missense probably damaging 1.00
R2064:Hk1 UTSW 10 62286536 missense probably benign 0.03
R3236:Hk1 UTSW 10 62296019 unclassified probably null
R3788:Hk1 UTSW 10 62275688 missense possibly damaging 0.85
R3977:Hk1 UTSW 10 62290319 missense probably benign 0.10
R4373:Hk1 UTSW 10 62315540 missense probably damaging 0.98
R4377:Hk1 UTSW 10 62315540 missense probably damaging 0.98
R4435:Hk1 UTSW 10 62275844 missense probably damaging 1.00
R4609:Hk1 UTSW 10 62358415 utr 5 prime probably benign
R4648:Hk1 UTSW 10 62304779 missense probably benign 0.00
R4864:Hk1 UTSW 10 62342539 missense probably benign 0.00
R4934:Hk1 UTSW 10 62358386 utr 5 prime probably benign
R5110:Hk1 UTSW 10 62286651 missense probably damaging 1.00
R5352:Hk1 UTSW 10 62304770 missense probably damaging 0.97
R5569:Hk1 UTSW 10 62286441 missense probably benign 0.35
R5609:Hk1 UTSW 10 62342551 missense probably benign 0.30
R5647:Hk1 UTSW 10 62275744 missense probably damaging 0.99
R5750:Hk1 UTSW 10 62274466 missense possibly damaging 0.86
R5770:Hk1 UTSW 10 62286449 missense probably benign
R5832:Hk1 UTSW 10 62292365 missense probably benign 0.17
R5905:Hk1 UTSW 10 62353058 missense probably null 0.82
R5933:Hk1 UTSW 10 62269994 missense probably damaging 1.00
R6028:Hk1 UTSW 10 62353058 missense probably null 0.82
R6196:Hk1 UTSW 10 62299259 missense probably damaging 1.00
R6314:Hk1 UTSW 10 62292444 missense possibly damaging 0.93
R6372:Hk1 UTSW 10 62291978 missense probably benign
R6801:Hk1 UTSW 10 62281131 missense probably damaging 0.97
R6838:Hk1 UTSW 10 62271658 missense probably damaging 0.98
R7045:Hk1 UTSW 10 62286570 missense probably damaging 1.00
R7420:Hk1 UTSW 10 62269982 missense probably damaging 1.00
R7491:Hk1 UTSW 10 62295745 missense probably damaging 1.00
R7527:Hk1 UTSW 10 62304782 missense probably damaging 0.99
R7561:Hk1 UTSW 10 62281028 splice site probably null
R8031:Hk1 UTSW 10 62296699 missense probably benign 0.15
X0018:Hk1 UTSW 10 62275706 missense probably benign 0.02
X0063:Hk1 UTSW 10 62275704 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCTGTTGGAAAGACAGGTTTCAC -3'
(R):5'- AGGGAGTCAACAGCCTTCTC -3'

Sequencing Primer
(F):5'- GGTTTCACAGAGCATTCAGC -3'
(R):5'- AACAGCCTTCTCTGGTGC -3'
Posted On2015-07-06