Incidental Mutation 'R4374:Tbc1d30'
ID325038
Institutional Source Beutler Lab
Gene Symbol Tbc1d30
Ensembl Gene ENSMUSG00000052302
Gene NameTBC1 domain family, member 30
Synonyms4930505D03Rik
MMRRC Submission 041118-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4374 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location121263820-121351278 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121294712 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 271 (F271S)
Ref Sequence ENSEMBL: ENSMUSP00000070488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064107]
Predicted Effect probably damaging
Transcript: ENSMUST00000064107
AA Change: F271S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070488
Gene: ENSMUSG00000052302
AA Change: F271S

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
TBC 84 318 2.22e-30 SMART
low complexity region 392 403 N/A INTRINSIC
Pfam:DUF4682 475 613 4.3e-50 PFAM
low complexity region 623 633 N/A INTRINSIC
low complexity region 649 657 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218688
Meta Mutation Damage Score 0.6390 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Abhd2 A G 7: 79,323,530 M86V probably benign Het
Acin1 C A 14: 54,653,894 probably benign Het
Aebp2 T A 6: 140,654,258 probably benign Het
Akap13 A G 7: 75,608,984 E452G probably damaging Het
Amz1 T C 5: 140,752,439 S184P possibly damaging Het
Ccdc83 A T 7: 90,226,778 L295* probably null Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cpsf7 A T 19: 10,539,637 I368F probably damaging Het
Csf1r G A 18: 61,119,006 C520Y probably damaging Het
Dapk1 A G 13: 60,719,684 D235G probably benign Het
Ercc1 G A 7: 19,347,132 probably benign Het
Fktn T C 4: 53,720,201 S72P probably damaging Het
Frem2 C A 3: 53,545,502 V2189F possibly damaging Het
Gm10845 G T 14: 79,863,123 noncoding transcript Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Lama1 A G 17: 67,804,518 M2255V probably benign Het
Lrsam1 G T 2: 32,955,191 T104K possibly damaging Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Myo7a G A 7: 98,102,674 T54M probably damaging Het
Olfr178 A C 16: 58,889,879 C114G probably benign Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pfkp A G 13: 6,620,989 S135P probably damaging Het
Phf20l1 C T 15: 66,604,837 T260I possibly damaging Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Ppp6r2 T G 15: 89,265,158 C216W probably damaging Het
Pramel7 C T 2: 87,490,071 A293T probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Scamp3 G A 3: 89,181,927 probably null Het
Setbp1 T C 18: 78,859,922 R177G probably damaging Het
Sh2b3 G T 5: 121,828,486 probably benign Het
Tpo T C 12: 30,103,152 E401G possibly damaging Het
Zdhhc13 T C 7: 48,808,841 Y308H probably damaging Het
Zfp112 C T 7: 24,126,373 H589Y probably damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Tbc1d30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Tbc1d30 APN 10 121266824 utr 3 prime probably benign
IGL00837:Tbc1d30 APN 10 121296845 missense probably damaging 1.00
IGL01081:Tbc1d30 APN 10 121267414 missense probably damaging 1.00
IGL01813:Tbc1d30 APN 10 121267051 missense probably benign
IGL01844:Tbc1d30 APN 10 121267179 missense probably benign 0.01
R1782:Tbc1d30 UTSW 10 121267620 missense probably damaging 1.00
R1972:Tbc1d30 UTSW 10 121306230 splice site probably null
R2025:Tbc1d30 UTSW 10 121279146 missense probably benign 0.18
R2197:Tbc1d30 UTSW 10 121304407 missense probably damaging 1.00
R3752:Tbc1d30 UTSW 10 121272168 missense probably damaging 1.00
R4540:Tbc1d30 UTSW 10 121279158 missense probably damaging 0.99
R4624:Tbc1d30 UTSW 10 121296786 missense probably damaging 0.99
R4960:Tbc1d30 UTSW 10 121267216 missense probably benign 0.04
R5170:Tbc1d30 UTSW 10 121306838 missense possibly damaging 0.49
R5566:Tbc1d30 UTSW 10 121302110 missense probably damaging 1.00
R5642:Tbc1d30 UTSW 10 121296787 missense probably damaging 1.00
R5726:Tbc1d30 UTSW 10 121267574 missense probably damaging 1.00
R6051:Tbc1d30 UTSW 10 121296845 missense probably damaging 1.00
R6364:Tbc1d30 UTSW 10 121294725 missense possibly damaging 0.95
R7106:Tbc1d30 UTSW 10 121301992 missense possibly damaging 0.94
R7233:Tbc1d30 UTSW 10 121272057 missense probably benign 0.35
R7256:Tbc1d30 UTSW 10 121288965 missense probably damaging 1.00
R7826:Tbc1d30 UTSW 10 121296805 missense probably damaging 1.00
R7910:Tbc1d30 UTSW 10 121347156 nonsense probably null
R7991:Tbc1d30 UTSW 10 121347156 nonsense probably null
R8021:Tbc1d30 UTSW 10 121267543 missense probably benign 0.09
Z1176:Tbc1d30 UTSW 10 121302113 missense probably damaging 1.00
Z1177:Tbc1d30 UTSW 10 121351064 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCCCACACTTTGCTCTGAGG -3'
(R):5'- ATGTTTCCTCTAGAAAGATGGGAGG -3'

Sequencing Primer
(F):5'- CCTCAGGATGATCTCTGAAC -3'
(R):5'- CCTCTAGAAAGATGGGAGGGAAAAAG -3'
Posted On2015-07-06