Incidental Mutation 'R4374:Pfkp'
ID325040
Institutional Source Beutler Lab
Gene Symbol Pfkp
Ensembl Gene ENSMUSG00000021196
Gene Namephosphofructokinase, platelet
Synonyms9330125N24Rik, 1200015H23Rik, PFK-C
MMRRC Submission 041118-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R4374 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location6579768-6648777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6620989 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 135 (S135P)
Ref Sequence ENSEMBL: ENSMUSP00000115313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021614] [ENSMUST00000136585] [ENSMUST00000138703]
Predicted Effect probably damaging
Transcript: ENSMUST00000021614
AA Change: S172P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021614
Gene: ENSMUSG00000021196
AA Change: S172P

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:PFK 25 332 4.7e-114 PFAM
Pfam:PFK 411 696 1.2e-96 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135761
Predicted Effect probably damaging
Transcript: ENSMUST00000136585
AA Change: S135P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115313
Gene: ENSMUSG00000021196
AA Change: S135P

DomainStartEndE-ValueType
Pfam:PFK 1 167 1.1e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137327
Predicted Effect probably damaging
Transcript: ENSMUST00000138703
AA Change: S172P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117030
Gene: ENSMUSG00000021196
AA Change: S172P

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:PFK 24 334 6.7e-136 PFAM
Pfam:PFK 410 698 1.1e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148999
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151894
Meta Mutation Damage Score 0.9733 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphofructokinase A protein family. The encoded enzyme is the platelet-specific isoform of phosphofructokinase and plays a key role in glycolysis regulation. This gene may play a role in metabolic reprogramming in some cancers, including clear cell renal cell carcinomas, and cancer of the bladder, breast, and lung. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Abhd2 A G 7: 79,323,530 M86V probably benign Het
Acin1 C A 14: 54,653,894 probably benign Het
Aebp2 T A 6: 140,654,258 probably benign Het
Akap13 A G 7: 75,608,984 E452G probably damaging Het
Amz1 T C 5: 140,752,439 S184P possibly damaging Het
Ccdc83 A T 7: 90,226,778 L295* probably null Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cpsf7 A T 19: 10,539,637 I368F probably damaging Het
Csf1r G A 18: 61,119,006 C520Y probably damaging Het
Dapk1 A G 13: 60,719,684 D235G probably benign Het
Ercc1 G A 7: 19,347,132 probably benign Het
Fktn T C 4: 53,720,201 S72P probably damaging Het
Frem2 C A 3: 53,545,502 V2189F possibly damaging Het
Gm10845 G T 14: 79,863,123 noncoding transcript Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Lama1 A G 17: 67,804,518 M2255V probably benign Het
Lrsam1 G T 2: 32,955,191 T104K possibly damaging Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Myo7a G A 7: 98,102,674 T54M probably damaging Het
Olfr178 A C 16: 58,889,879 C114G probably benign Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Phf20l1 C T 15: 66,604,837 T260I possibly damaging Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Ppp6r2 T G 15: 89,265,158 C216W probably damaging Het
Pramel7 C T 2: 87,490,071 A293T probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Scamp3 G A 3: 89,181,927 probably null Het
Setbp1 T C 18: 78,859,922 R177G probably damaging Het
Sh2b3 G T 5: 121,828,486 probably benign Het
Tbc1d30 A G 10: 121,294,712 F271S probably damaging Het
Tpo T C 12: 30,103,152 E401G possibly damaging Het
Zdhhc13 T C 7: 48,808,841 Y308H probably damaging Het
Zfp112 C T 7: 24,126,373 H589Y probably damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Pfkp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Pfkp APN 13 6619550 missense probably damaging 1.00
IGL00983:Pfkp APN 13 6581567 missense probably damaging 1.00
IGL01099:Pfkp APN 13 6603390 splice site probably benign
IGL01825:Pfkp APN 13 6620978 missense probably damaging 1.00
IGL02164:Pfkp APN 13 6597915 missense probably damaging 1.00
IGL02331:Pfkp APN 13 6597960 missense probably benign 0.33
IGL02680:Pfkp APN 13 6600672 unclassified probably benign
IGL02852:Pfkp APN 13 6605023 missense possibly damaging 0.57
R0414:Pfkp UTSW 13 6593210 missense probably benign 0.03
R0542:Pfkp UTSW 13 6621992 nonsense probably null
R0612:Pfkp UTSW 13 6605634 critical splice donor site probably null
R0767:Pfkp UTSW 13 6605012 missense probably damaging 0.98
R1417:Pfkp UTSW 13 6605719 missense probably benign 0.00
R1534:Pfkp UTSW 13 6619538 missense probably damaging 1.00
R1612:Pfkp UTSW 13 6588589 missense probably damaging 1.00
R2278:Pfkp UTSW 13 6619209 unclassified probably null
R2919:Pfkp UTSW 13 6593243 missense probably damaging 0.98
R2996:Pfkp UTSW 13 6635930 missense probably benign 0.01
R4214:Pfkp UTSW 13 6619225 missense probably damaging 0.99
R4693:Pfkp UTSW 13 6600635 missense possibly damaging 0.91
R5534:Pfkp UTSW 13 6648583 missense probably damaging 1.00
R5537:Pfkp UTSW 13 6619242 missense probably damaging 1.00
R5619:Pfkp UTSW 13 6598729 unclassified probably benign
R5677:Pfkp UTSW 13 6588595 missense probably damaging 1.00
R6038:Pfkp UTSW 13 6597969 missense probably benign 0.14
R6038:Pfkp UTSW 13 6597969 missense probably benign 0.14
R6216:Pfkp UTSW 13 6619188 missense probably benign 0.00
R6330:Pfkp UTSW 13 6585250 unclassified probably benign
R6676:Pfkp UTSW 13 6586539 missense possibly damaging 0.74
R7044:Pfkp UTSW 13 6581567 missense probably damaging 1.00
R7146:Pfkp UTSW 13 6602781 missense probably benign 0.00
R7193:Pfkp UTSW 13 6593216 missense probably benign 0.00
R7588:Pfkp UTSW 13 6648637 missense possibly damaging 0.81
R7611:Pfkp UTSW 13 6605083 critical splice acceptor site probably null
R7821:Pfkp UTSW 13 6597872 missense probably damaging 1.00
Z1177:Pfkp UTSW 13 6619252 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- ACTAACATGGGATCTGCTGAGTG -3'
(R):5'- AAAGTTGCTGATCTGCATTCTCTC -3'

Sequencing Primer
(F):5'- GTTTCTGGAACCAGCAGTAATAGCC -3'
(R):5'- AGGATTCTATGTGAACTCTTGGCCC -3'
Posted On2015-07-06