Incidental Mutation 'R4374:Zmiz1'
ID325042
Institutional Source Beutler Lab
Gene Symbol Zmiz1
Ensembl Gene ENSMUSG00000007817
Gene Namezinc finger, MIZ-type containing 1
SynonymsRai17, Zimp10
MMRRC Submission 041118-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4374 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location25459185-25666743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25636010 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 140 (S140P)
Ref Sequence ENSEMBL: ENSMUSP00000124863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007961] [ENSMUST00000162645]
Predicted Effect probably damaging
Transcript: ENSMUST00000007961
AA Change: S140P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000007961
Gene: ENSMUSG00000007817
AA Change: S140P

DomainStartEndE-ValueType
low complexity region 123 142 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 239 268 N/A INTRINSIC
SCOP:d1gkub1 280 323 1e-3 SMART
low complexity region 431 446 N/A INTRINSIC
low complexity region 483 495 N/A INTRINSIC
low complexity region 498 505 N/A INTRINSIC
low complexity region 511 526 N/A INTRINSIC
Pfam:zf-Nse 731 786 3.5e-8 PFAM
Pfam:zf-MIZ 739 788 7.6e-26 PFAM
low complexity region 867 881 N/A INTRINSIC
low complexity region 982 997 N/A INTRINSIC
low complexity region 1039 1062 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160229
SMART Domains Protein: ENSMUSP00000124820
Gene: ENSMUSG00000007817

DomainStartEndE-ValueType
low complexity region 59 77 N/A INTRINSIC
low complexity region 115 144 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162645
AA Change: S140P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124863
Gene: ENSMUSG00000007817
AA Change: S140P

DomainStartEndE-ValueType
low complexity region 123 142 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 239 268 N/A INTRINSIC
SCOP:d1gkub1 280 309 2e-3 SMART
low complexity region 437 452 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 504 511 N/A INTRINSIC
low complexity region 517 532 N/A INTRINSIC
Pfam:zf-MIZ 745 794 2.1e-26 PFAM
low complexity region 873 887 N/A INTRINSIC
low complexity region 988 1003 N/A INTRINSIC
low complexity region 1045 1068 N/A INTRINSIC
Meta Mutation Damage Score 0.0732 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PIAS (protein inhibitor of activated STAT) family of proteins. The encoded protein regulates the activity of various transcription factors, including the androgen receptor, Smad3/4, and p53. The encoded protein may also play a role in sumoylation. A translocation between this locus on chromosome 10 and the protein tyrosine kinase ABL1 locus on chromosome 9 has been associated with acute lymphoblastic leukemia. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with failure of yolk sac vascular remodeling and abnormal embryonic vascular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Abhd2 A G 7: 79,323,530 M86V probably benign Het
Acin1 C A 14: 54,653,894 probably benign Het
Aebp2 T A 6: 140,654,258 probably benign Het
Akap13 A G 7: 75,608,984 E452G probably damaging Het
Amz1 T C 5: 140,752,439 S184P possibly damaging Het
Ccdc83 A T 7: 90,226,778 L295* probably null Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cpsf7 A T 19: 10,539,637 I368F probably damaging Het
Csf1r G A 18: 61,119,006 C520Y probably damaging Het
Dapk1 A G 13: 60,719,684 D235G probably benign Het
Ercc1 G A 7: 19,347,132 probably benign Het
Fktn T C 4: 53,720,201 S72P probably damaging Het
Frem2 C A 3: 53,545,502 V2189F possibly damaging Het
Gm10845 G T 14: 79,863,123 noncoding transcript Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Lama1 A G 17: 67,804,518 M2255V probably benign Het
Lrsam1 G T 2: 32,955,191 T104K possibly damaging Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Myo7a G A 7: 98,102,674 T54M probably damaging Het
Olfr178 A C 16: 58,889,879 C114G probably benign Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pfkp A G 13: 6,620,989 S135P probably damaging Het
Phf20l1 C T 15: 66,604,837 T260I possibly damaging Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Ppp6r2 T G 15: 89,265,158 C216W probably damaging Het
Pramel7 C T 2: 87,490,071 A293T probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Scamp3 G A 3: 89,181,927 probably null Het
Setbp1 T C 18: 78,859,922 R177G probably damaging Het
Sh2b3 G T 5: 121,828,486 probably benign Het
Tbc1d30 A G 10: 121,294,712 F271S probably damaging Het
Tpo T C 12: 30,103,152 E401G possibly damaging Het
Zdhhc13 T C 7: 48,808,841 Y308H probably damaging Het
Zfp112 C T 7: 24,126,373 H589Y probably damaging Het
Other mutations in Zmiz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Zmiz1 APN 14 25572070 start codon destroyed probably null 0.53
IGL01582:Zmiz1 APN 14 25658230 missense probably benign 0.00
IGL01601:Zmiz1 APN 14 25581644 missense possibly damaging 0.68
IGL02008:Zmiz1 APN 14 25656879 missense probably damaging 0.97
IGL02395:Zmiz1 APN 14 25656763 missense probably damaging 1.00
IGL02836:Zmiz1 APN 14 25656742 splice site probably benign
zapp UTSW 14 25662980 missense unknown
R0144:Zmiz1 UTSW 14 25655247 missense probably damaging 1.00
R0255:Zmiz1 UTSW 14 25654495 splice site probably benign
R1006:Zmiz1 UTSW 14 25662980 missense unknown
R1160:Zmiz1 UTSW 14 25654512 missense probably damaging 1.00
R1222:Zmiz1 UTSW 14 25658096 splice site probably benign
R2846:Zmiz1 UTSW 14 25645675 missense probably benign 0.03
R4126:Zmiz1 UTSW 14 25656930 missense possibly damaging 0.94
R4373:Zmiz1 UTSW 14 25636010 missense probably damaging 0.97
R4377:Zmiz1 UTSW 14 25636010 missense probably damaging 0.97
R4533:Zmiz1 UTSW 14 25645660 missense probably damaging 1.00
R4726:Zmiz1 UTSW 14 25643674 critical splice donor site probably null
R5295:Zmiz1 UTSW 14 25656347 missense probably damaging 1.00
R5385:Zmiz1 UTSW 14 25649813 missense probably damaging 1.00
R5579:Zmiz1 UTSW 14 25644856 missense probably damaging 0.96
R5761:Zmiz1 UTSW 14 25651304 missense possibly damaging 0.86
R5761:Zmiz1 UTSW 14 25651306 missense probably damaging 1.00
R5844:Zmiz1 UTSW 14 25656930 missense probably damaging 1.00
R5875:Zmiz1 UTSW 14 25635966 missense possibly damaging 0.55
R6051:Zmiz1 UTSW 14 25572070 start codon destroyed probably null 0.53
R6919:Zmiz1 UTSW 14 25643638 missense probably damaging 1.00
R7083:Zmiz1 UTSW 14 25651948 missense probably damaging 1.00
R7216:Zmiz1 UTSW 14 25576200 frame shift probably null
R7216:Zmiz1 UTSW 14 25576207 missense probably damaging 0.99
R7216:Zmiz1 UTSW 14 25576209 missense probably damaging 0.99
R7233:Zmiz1 UTSW 14 25649668 missense possibly damaging 0.61
X0023:Zmiz1 UTSW 14 25649684 missense probably damaging 0.96
Z1176:Zmiz1 UTSW 14 25645744 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTCCACTGACCATCTGTC -3'
(R):5'- CTTTGGTTAGAGGGAAGGCTCC -3'

Sequencing Primer
(F):5'- GACCATCTGTCTTTGCTTGCAG -3'
(R):5'- GGGAAGGCTCCAAACTCATGATTC -3'
Posted On2015-07-06