Incidental Mutation 'R4374:Acin1'
ID325044
Institutional Source Beutler Lab
Gene Symbol Acin1
Ensembl Gene ENSMUSG00000022185
Gene Nameapoptotic chromatin condensation inducer 1
Synonyms2610510L13Rik, Acinus, 2610036I19Rik
MMRRC Submission 041118-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R4374 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location54642161-54686931 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 54653894 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022793] [ENSMUST00000022794] [ENSMUST00000111484] [ENSMUST00000123875] [ENSMUST00000126166] [ENSMUST00000141453] [ENSMUST00000148754] [ENSMUST00000150371] [ENSMUST00000167015]
Predicted Effect probably benign
Transcript: ENSMUST00000022793
SMART Domains Protein: ENSMUSP00000022793
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
SAP 72 106 1.29e-8 SMART
coiled coil region 138 175 N/A INTRINSIC
low complexity region 205 220 N/A INTRINSIC
coiled coil region 259 300 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 414 423 N/A INTRINSIC
low complexity region 573 603 N/A INTRINSIC
low complexity region 631 662 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
low complexity region 760 773 N/A INTRINSIC
low complexity region 778 792 N/A INTRINSIC
low complexity region 803 813 N/A INTRINSIC
internal_repeat_1 817 892 1.63e-6 PROSPERO
low complexity region 927 952 N/A INTRINSIC
RRM 1012 1081 8.3e-2 SMART
Pfam:RSB_motif 1139 1246 5.7e-30 PFAM
low complexity region 1275 1329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000022794
SMART Domains Protein: ENSMUSP00000022794
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
low complexity region 169 194 N/A INTRINSIC
RRM 254 323 8.3e-2 SMART
low complexity region 355 405 N/A INTRINSIC
low complexity region 412 450 N/A INTRINSIC
PDB:4A8X|B 451 475 4e-6 PDB
low complexity region 477 512 N/A INTRINSIC
low complexity region 517 571 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111484
SMART Domains Protein: ENSMUSP00000107109
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
SAP 72 106 1.29e-8 SMART
coiled coil region 138 172 N/A INTRINSIC
coiled coil region 219 260 N/A INTRINSIC
low complexity region 338 356 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 591 622 N/A INTRINSIC
low complexity region 694 703 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
low complexity region 738 752 N/A INTRINSIC
low complexity region 763 773 N/A INTRINSIC
internal_repeat_1 777 852 1.21e-6 PROSPERO
low complexity region 887 912 N/A INTRINSIC
RRM 972 1041 8.3e-2 SMART
low complexity region 1073 1123 N/A INTRINSIC
low complexity region 1130 1168 N/A INTRINSIC
coiled coil region 1188 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123875
SMART Domains Protein: ENSMUSP00000117210
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
low complexity region 112 122 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126166
SMART Domains Protein: ENSMUSP00000114546
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 30 40 N/A INTRINSIC
low complexity region 154 179 N/A INTRINSIC
RRM 239 308 8.3e-2 SMART
low complexity region 340 390 N/A INTRINSIC
low complexity region 397 435 N/A INTRINSIC
PDB:4A8X|B 436 460 4e-6 PDB
low complexity region 462 497 N/A INTRINSIC
low complexity region 502 556 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137763
Predicted Effect probably benign
Transcript: ENSMUST00000141453
SMART Domains Protein: ENSMUSP00000116664
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 30 40 N/A INTRINSIC
low complexity region 141 166 N/A INTRINSIC
RRM 226 295 8.3e-2 SMART
low complexity region 327 377 N/A INTRINSIC
low complexity region 384 422 N/A INTRINSIC
PDB:4A8X|B 423 447 4e-6 PDB
low complexity region 449 484 N/A INTRINSIC
low complexity region 489 543 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147714
SMART Domains Protein: ENSMUSP00000119080
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
SAP 18 52 1.29e-8 SMART
coiled coil region 83 120 N/A INTRINSIC
low complexity region 151 166 N/A INTRINSIC
coiled coil region 204 245 N/A INTRINSIC
low complexity region 324 342 N/A INTRINSIC
low complexity region 360 369 N/A INTRINSIC
low complexity region 519 549 N/A INTRINSIC
low complexity region 577 608 N/A INTRINSIC
low complexity region 680 689 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
low complexity region 724 738 N/A INTRINSIC
low complexity region 749 759 N/A INTRINSIC
low complexity region 861 886 N/A INTRINSIC
RRM 946 1015 8.3e-2 SMART
Pfam:RSB_motif 1065 1180 1.1e-29 PFAM
low complexity region 1209 1263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148754
SMART Domains Protein: ENSMUSP00000122003
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
low complexity region 170 195 N/A INTRINSIC
RRM 255 324 8.3e-2 SMART
low complexity region 356 406 N/A INTRINSIC
low complexity region 413 451 N/A INTRINSIC
PDB:4A8X|B 452 476 4e-6 PDB
low complexity region 478 513 N/A INTRINSIC
low complexity region 518 572 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149713
Predicted Effect probably benign
Transcript: ENSMUST00000150371
SMART Domains Protein: ENSMUSP00000118069
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 99 109 N/A INTRINSIC
low complexity region 223 248 N/A INTRINSIC
RRM 308 377 8.3e-2 SMART
low complexity region 409 459 N/A INTRINSIC
low complexity region 466 504 N/A INTRINSIC
PDB:4A8X|B 505 529 3e-6 PDB
low complexity region 531 566 N/A INTRINSIC
low complexity region 571 625 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167015
SMART Domains Protein: ENSMUSP00000125776
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
low complexity region 170 195 N/A INTRINSIC
RRM 255 324 8.3e-2 SMART
low complexity region 356 406 N/A INTRINSIC
low complexity region 413 451 N/A INTRINSIC
PDB:4A8X|B 452 476 4e-6 PDB
low complexity region 478 513 N/A INTRINSIC
low complexity region 518 572 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170299
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Apoptosis is defined by several morphologic nuclear changes, including chromatin condensation and nuclear fragmentation. This gene encodes a nuclear protein that induces apoptotic chromatin condensation after activation by caspase-3, without inducing DNA fragmentation. This protein has also been shown to be a component of a splicing-dependent multiprotein exon junction complex (EJC) that is deposited at splice junctions on mRNAs, as a consequence of pre-mRNA splicing. It may thus be involved in mRNA metabolism associated with splicing. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Abhd2 A G 7: 79,323,530 M86V probably benign Het
Aebp2 T A 6: 140,654,258 probably benign Het
Akap13 A G 7: 75,608,984 E452G probably damaging Het
Amz1 T C 5: 140,752,439 S184P possibly damaging Het
Ccdc83 A T 7: 90,226,778 L295* probably null Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cpsf7 A T 19: 10,539,637 I368F probably damaging Het
Csf1r G A 18: 61,119,006 C520Y probably damaging Het
Dapk1 A G 13: 60,719,684 D235G probably benign Het
Ercc1 G A 7: 19,347,132 probably benign Het
Fktn T C 4: 53,720,201 S72P probably damaging Het
Frem2 C A 3: 53,545,502 V2189F possibly damaging Het
Gm10845 G T 14: 79,863,123 noncoding transcript Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Lama1 A G 17: 67,804,518 M2255V probably benign Het
Lrsam1 G T 2: 32,955,191 T104K possibly damaging Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Myo7a G A 7: 98,102,674 T54M probably damaging Het
Olfr178 A C 16: 58,889,879 C114G probably benign Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pfkp A G 13: 6,620,989 S135P probably damaging Het
Phf20l1 C T 15: 66,604,837 T260I possibly damaging Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Ppp6r2 T G 15: 89,265,158 C216W probably damaging Het
Pramel7 C T 2: 87,490,071 A293T probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Scamp3 G A 3: 89,181,927 probably null Het
Setbp1 T C 18: 78,859,922 R177G probably damaging Het
Sh2b3 G T 5: 121,828,486 probably benign Het
Tbc1d30 A G 10: 121,294,712 F271S probably damaging Het
Tpo T C 12: 30,103,152 E401G possibly damaging Het
Zdhhc13 T C 7: 48,808,841 Y308H probably damaging Het
Zfp112 C T 7: 24,126,373 H589Y probably damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Acin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Acin1 APN 14 54646800 missense probably damaging 1.00
IGL01530:Acin1 APN 14 54643986 missense probably damaging 1.00
IGL02396:Acin1 APN 14 54644799 intron probably benign
IGL02967:Acin1 APN 14 54642753 missense possibly damaging 0.80
Protuberant UTSW 14 54645283 missense probably damaging 1.00
R0411:Acin1 UTSW 14 54646774 missense probably damaging 1.00
R0723:Acin1 UTSW 14 54665451 missense probably damaging 0.98
R0755:Acin1 UTSW 14 54651835 start codon destroyed probably null 0.93
R0784:Acin1 UTSW 14 54653528 unclassified probably benign
R1600:Acin1 UTSW 14 54643717 intron probably benign
R1682:Acin1 UTSW 14 54663718 missense probably damaging 1.00
R1721:Acin1 UTSW 14 54664538 missense probably benign 0.01
R1756:Acin1 UTSW 14 54665204 missense probably benign 0.30
R1867:Acin1 UTSW 14 54644261 missense probably damaging 1.00
R1997:Acin1 UTSW 14 54646699 splice site probably null
R2067:Acin1 UTSW 14 54665254 missense probably damaging 1.00
R3947:Acin1 UTSW 14 54679333 missense possibly damaging 0.89
R4476:Acin1 UTSW 14 54645330 missense probably damaging 1.00
R4501:Acin1 UTSW 14 54686587 missense probably damaging 1.00
R4547:Acin1 UTSW 14 54645667 missense probably benign 0.01
R4621:Acin1 UTSW 14 54653443 unclassified probably benign
R4657:Acin1 UTSW 14 54643047 missense possibly damaging 0.93
R4680:Acin1 UTSW 14 54686758 missense probably benign 0.00
R4696:Acin1 UTSW 14 54643017 intron probably benign
R4806:Acin1 UTSW 14 54679228 splice site probably benign
R4826:Acin1 UTSW 14 54664617 missense probably damaging 0.97
R5096:Acin1 UTSW 14 54679222 intron probably benign
R5153:Acin1 UTSW 14 54645613 missense probably benign 0.25
R5223:Acin1 UTSW 14 54642941 frame shift probably null
R5260:Acin1 UTSW 14 54642822 intron probably benign
R5525:Acin1 UTSW 14 54664391 missense possibly damaging 0.94
R5575:Acin1 UTSW 14 54678738 splice site probably null
R5902:Acin1 UTSW 14 54663673 missense probably benign 0.01
R6211:Acin1 UTSW 14 54644046 missense probably damaging 1.00
R6524:Acin1 UTSW 14 54645283 missense probably damaging 1.00
R6560:Acin1 UTSW 14 54678833 missense probably benign 0.24
R6916:Acin1 UTSW 14 54665416 missense probably benign 0.27
R7201:Acin1 UTSW 14 54664899 missense possibly damaging 0.83
X0021:Acin1 UTSW 14 54667101 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGCCATCTTGCCACTTAC -3'
(R):5'- ATGGGCACATAAGAAAATGCTGTC -3'

Sequencing Primer
(F):5'- TTGCCACTTACCCAGCAG -3'
(R):5'- AGAAAATGCTGTCTTGATGTTCTGAG -3'
Posted On2015-07-06