Incidental Mutation 'R4374:Setbp1'
ID325053
Institutional Source Beutler Lab
Gene Symbol Setbp1
Ensembl Gene ENSMUSG00000024548
Gene NameSET binding protein 1
SynonymsSeb
MMRRC Submission 041118-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.535) question?
Stock #R4374 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location78750380-79109391 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78859922 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 177 (R177G)
Ref Sequence ENSEMBL: ENSMUSP00000025430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025430]
Predicted Effect probably damaging
Transcript: ENSMUST00000025430
AA Change: R177G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025430
Gene: ENSMUSG00000024548
AA Change: R177G

DomainStartEndE-ValueType
low complexity region 155 165 N/A INTRINSIC
low complexity region 221 251 N/A INTRINSIC
low complexity region 278 286 N/A INTRINSIC
AT_hook 528 540 4.64e-1 SMART
low complexity region 565 571 N/A INTRINSIC
low complexity region 594 617 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
AT_hook 960 972 1.89e-1 SMART
low complexity region 1086 1103 N/A INTRINSIC
low complexity region 1316 1337 N/A INTRINSIC
AT_hook 1393 1405 7.27e-1 SMART
low complexity region 1462 1486 N/A INTRINSIC
low complexity region 1498 1514 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161465
AA Change: R177G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124497
Gene: ENSMUSG00000024548
AA Change: R177G

DomainStartEndE-ValueType
low complexity region 46 55 N/A INTRINSIC
low complexity region 202 212 N/A INTRINSIC
low complexity region 268 298 N/A INTRINSIC
low complexity region 325 333 N/A INTRINSIC
AT_hook 575 587 4.64e-1 SMART
low complexity region 612 618 N/A INTRINSIC
low complexity region 641 664 N/A INTRINSIC
low complexity region 925 934 N/A INTRINSIC
AT_hook 1007 1019 1.89e-1 SMART
low complexity region 1133 1150 N/A INTRINSIC
low complexity region 1363 1384 N/A INTRINSIC
AT_hook 1440 1452 7.27e-1 SMART
low complexity region 1509 1533 N/A INTRINSIC
low complexity region 1545 1561 N/A INTRINSIC
Meta Mutation Damage Score 0.2440 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a several motifs including a ski homology region and a SET-binding region in addition to three nuclear localization signals. The encoded protein has been shown to bind the SET nuclear oncogene which is involved in DNA replication. Mutations in this gene are associated with Schinzel-Giedion midface retraction syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Abhd2 A G 7: 79,323,530 M86V probably benign Het
Acin1 C A 14: 54,653,894 probably benign Het
Aebp2 T A 6: 140,654,258 probably benign Het
Akap13 A G 7: 75,608,984 E452G probably damaging Het
Amz1 T C 5: 140,752,439 S184P possibly damaging Het
Ccdc83 A T 7: 90,226,778 L295* probably null Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cpsf7 A T 19: 10,539,637 I368F probably damaging Het
Csf1r G A 18: 61,119,006 C520Y probably damaging Het
Dapk1 A G 13: 60,719,684 D235G probably benign Het
Ercc1 G A 7: 19,347,132 probably benign Het
Fktn T C 4: 53,720,201 S72P probably damaging Het
Frem2 C A 3: 53,545,502 V2189F possibly damaging Het
Gm10845 G T 14: 79,863,123 noncoding transcript Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Lama1 A G 17: 67,804,518 M2255V probably benign Het
Lrsam1 G T 2: 32,955,191 T104K possibly damaging Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Myo7a G A 7: 98,102,674 T54M probably damaging Het
Olfr178 A C 16: 58,889,879 C114G probably benign Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pfkp A G 13: 6,620,989 S135P probably damaging Het
Phf20l1 C T 15: 66,604,837 T260I possibly damaging Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Ppp6r2 T G 15: 89,265,158 C216W probably damaging Het
Pramel7 C T 2: 87,490,071 A293T probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Scamp3 G A 3: 89,181,927 probably null Het
Sh2b3 G T 5: 121,828,486 probably benign Het
Tbc1d30 A G 10: 121,294,712 F271S probably damaging Het
Tpo T C 12: 30,103,152 E401G possibly damaging Het
Zdhhc13 T C 7: 48,808,841 Y308H probably damaging Het
Zfp112 C T 7: 24,126,373 H589Y probably damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Setbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Setbp1 APN 18 78755679 nonsense probably null 0.00
IGL00668:Setbp1 APN 18 78857770 missense probably damaging 1.00
IGL01628:Setbp1 APN 18 78856777 missense probably damaging 1.00
IGL02084:Setbp1 APN 18 78857410 missense probably damaging 1.00
IGL02405:Setbp1 APN 18 78857299 missense probably damaging 1.00
IGL02427:Setbp1 APN 18 78857473 missense probably damaging 1.00
IGL02612:Setbp1 APN 18 78755710 missense probably damaging 1.00
IGL02725:Setbp1 APN 18 78857374 nonsense probably null
IGL03005:Setbp1 APN 18 78859125 missense possibly damaging 0.75
IGL03123:Setbp1 APN 18 78857009 missense probably damaging 1.00
R1083:Setbp1 UTSW 18 78857626 missense probably damaging 1.00
R1110:Setbp1 UTSW 18 78857860 missense probably damaging 1.00
R1167:Setbp1 UTSW 18 78857236 missense possibly damaging 0.85
R1221:Setbp1 UTSW 18 78856583 missense probably damaging 1.00
R1225:Setbp1 UTSW 18 78858208 missense probably damaging 0.99
R1327:Setbp1 UTSW 18 78783358 missense probably benign 0.00
R1481:Setbp1 UTSW 18 78783301 missense probably benign 0.01
R1482:Setbp1 UTSW 18 79086835 missense probably damaging 1.00
R1496:Setbp1 UTSW 18 78859912 missense probably damaging 1.00
R1550:Setbp1 UTSW 18 78858592 missense probably damaging 1.00
R1708:Setbp1 UTSW 18 78858467 missense probably damaging 0.99
R1751:Setbp1 UTSW 18 78857398 missense probably damaging 1.00
R1922:Setbp1 UTSW 18 78858362 missense possibly damaging 0.75
R1986:Setbp1 UTSW 18 78858544 missense probably damaging 0.99
R2090:Setbp1 UTSW 18 78856720 missense probably benign 0.00
R2851:Setbp1 UTSW 18 78923996 missense probably benign 0.11
R2853:Setbp1 UTSW 18 78923996 missense probably benign 0.11
R2941:Setbp1 UTSW 18 78858197 missense probably damaging 1.00
R3151:Setbp1 UTSW 18 78857435 missense probably damaging 1.00
R3156:Setbp1 UTSW 18 78859303 missense probably benign 0.00
R3807:Setbp1 UTSW 18 78783322 missense probably benign 0.01
R4133:Setbp1 UTSW 18 78856991 missense probably benign 0.05
R4287:Setbp1 UTSW 18 78859061 missense probably benign 0.03
R4345:Setbp1 UTSW 18 79086579 missense probably damaging 0.99
R4377:Setbp1 UTSW 18 78859922 missense probably damaging 0.97
R4378:Setbp1 UTSW 18 78856618 missense possibly damaging 0.95
R4379:Setbp1 UTSW 18 79086681 missense probably damaging 1.00
R4585:Setbp1 UTSW 18 79086949 missense probably benign 0.00
R4595:Setbp1 UTSW 18 78857516 missense probably benign 0.00
R4817:Setbp1 UTSW 18 78858800 missense probably damaging 1.00
R4971:Setbp1 UTSW 18 78858167 missense probably benign 0.07
R4976:Setbp1 UTSW 18 79086712 missense probably damaging 1.00
R5017:Setbp1 UTSW 18 78856594 missense possibly damaging 0.81
R5066:Setbp1 UTSW 18 78857299 missense probably damaging 1.00
R5133:Setbp1 UTSW 18 78857482 missense probably damaging 1.00
R5151:Setbp1 UTSW 18 78857999 missense probably damaging 1.00
R5237:Setbp1 UTSW 18 78856975 missense possibly damaging 0.92
R5480:Setbp1 UTSW 18 78858063 missense probably damaging 0.99
R5507:Setbp1 UTSW 18 79086712 missense probably damaging 1.00
R5529:Setbp1 UTSW 18 79086652 missense probably damaging 0.99
R5622:Setbp1 UTSW 18 78857485 missense probably damaging 1.00
R5722:Setbp1 UTSW 18 78856645 missense possibly damaging 0.95
R5806:Setbp1 UTSW 18 78856482 unclassified probably null
R5940:Setbp1 UTSW 18 78755488 missense probably damaging 1.00
R6025:Setbp1 UTSW 18 78859240 missense probably damaging 0.98
R6030:Setbp1 UTSW 18 78857711 missense probably benign 0.02
R6030:Setbp1 UTSW 18 78857711 missense probably benign 0.02
R6250:Setbp1 UTSW 18 78858002 missense probably benign 0.00
R6256:Setbp1 UTSW 18 78857257 missense probably damaging 1.00
R6332:Setbp1 UTSW 18 78783369 missense probably benign 0.21
R6522:Setbp1 UTSW 18 78857390 missense probably damaging 0.98
R6873:Setbp1 UTSW 18 78859559 missense probably benign 0.00
R6886:Setbp1 UTSW 18 78857500 missense probably damaging 1.00
R6986:Setbp1 UTSW 18 78857839 missense probably damaging 1.00
R7042:Setbp1 UTSW 18 79086855 missense probably damaging 1.00
R7131:Setbp1 UTSW 18 79086960 missense probably benign 0.08
R7134:Setbp1 UTSW 18 78859519 missense possibly damaging 0.86
R7215:Setbp1 UTSW 18 78856837 missense probably damaging 0.97
R7219:Setbp1 UTSW 18 78755745 missense probably damaging 1.00
R7378:Setbp1 UTSW 18 78857486 missense probably damaging 1.00
R7461:Setbp1 UTSW 18 78856492 missense probably benign 0.06
R7589:Setbp1 UTSW 18 78856492 missense probably benign 0.01
R7840:Setbp1 UTSW 18 78783424 missense probably benign 0.03
R7849:Setbp1 UTSW 18 78856853 missense probably benign 0.00
R7923:Setbp1 UTSW 18 78783424 missense probably benign 0.03
R7932:Setbp1 UTSW 18 78856853 missense probably benign 0.00
Z1088:Setbp1 UTSW 18 78859594 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGCCTCTGGACTGATGAAG -3'
(R):5'- TCCTTGCTAATGTCCAAATTCAGTG -3'

Sequencing Primer
(F):5'- GCCTCTGGACTGATGAAGCAATTC -3'
(R):5'- ATATTTGAGAAAAGCTCCCCTCTC -3'
Posted On2015-07-06