Incidental Mutation 'R4375:Olfr365'
ID 325057
Institutional Source Beutler Lab
Gene Symbol Olfr365
Ensembl Gene ENSMUSG00000059429
Gene Name olfactory receptor 365
Synonyms GA_x6K02T2NLDC-33885305-33886243, MOR138-1
MMRRC Submission 041119-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock # R4375 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 37188198-37206019 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37201562 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 107 (M107K)
Ref Sequence ENSEMBL: ENSMUSP00000151617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074168] [ENSMUST00000213969] [ENSMUST00000218602]
AlphaFold Q8VFT2
Predicted Effect probably benign
Transcript: ENSMUST00000074168
AA Change: M107K

PolyPhen 2 Score 0.328 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000073801
Gene: ENSMUSG00000059429
AA Change: M107K

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
Pfam:7tm_4 33 309 4.7e-58 PFAM
Pfam:7tm_1 43 292 2.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213969
AA Change: M107K

PolyPhen 2 Score 0.328 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000218602
AA Change: M107K

PolyPhen 2 Score 0.328 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.2931 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adhfe1 A T 1: 9,561,628 probably benign Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cntnap1 A G 11: 101,182,253 D561G probably damaging Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Cyp4b1 T C 4: 115,636,313 T191A probably benign Het
Dapk1 A T 13: 60,761,589 M1339L probably benign Het
Dpm3 T C 3: 89,266,908 Y59H probably damaging Het
Eif2ak4 A G 2: 118,427,924 Y585C probably damaging Het
Ercc1 G A 7: 19,347,132 probably benign Het
Fam184b T C 5: 45,542,343 D577G probably benign Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Hsf2bp C T 17: 31,987,348 D270N probably null Het
Lactbl1 T C 4: 136,637,591 V418A possibly damaging Het
Lifr A T 15: 7,166,898 M188L probably benign Het
Ltbp1 G T 17: 75,312,997 G760V probably damaging Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Nlrp12 A G 7: 3,240,946 L312P possibly damaging Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Olfr898 T C 9: 38,349,169 F23L probably benign Het
Pcdh17 T C 14: 84,448,271 V726A possibly damaging Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Phf20l1 T C 15: 66,615,222 S369P probably benign Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Proser3 A G 7: 30,540,671 V336A possibly damaging Het
Rbbp8 C T 18: 11,725,410 T646M probably benign Het
Rgs1 T C 1: 144,247,906 T94A probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Snx9 G A 17: 5,908,626 W292* probably null Het
St14 T C 9: 31,090,458 I784V probably benign Het
Strc A G 2: 121,380,823 S14P unknown Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Ubap1 G A 4: 41,371,850 probably null Het
Zfr T C 15: 12,118,340 probably null Het
Other mutations in Olfr365
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Olfr365 APN 2 37201597 missense probably damaging 1.00
IGL00943:Olfr365 APN 2 37202171 missense probably benign 0.08
IGL01100:Olfr365 APN 2 37201640 missense possibly damaging 0.58
IGL01696:Olfr365 APN 2 37201511 missense probably benign 0.00
IGL02119:Olfr365 APN 2 37201269 missense possibly damaging 0.73
IGL02807:Olfr365 APN 2 37201574 missense probably damaging 1.00
IGL03030:Olfr365 APN 2 37201871 missense probably benign 0.00
R0388:Olfr365 UTSW 2 37202184 splice site probably null
R0788:Olfr365 UTSW 2 37202023 missense possibly damaging 0.90
R1126:Olfr365 UTSW 2 37202101 missense probably benign
R1753:Olfr365 UTSW 2 37201427 missense probably damaging 1.00
R1822:Olfr365 UTSW 2 37201980 missense probably damaging 1.00
R1837:Olfr365 UTSW 2 37202102 missense probably benign 0.23
R3711:Olfr365 UTSW 2 37201273 missense probably benign
R4077:Olfr365 UTSW 2 37202012 missense possibly damaging 0.79
R4078:Olfr365 UTSW 2 37202012 missense possibly damaging 0.79
R4607:Olfr365 UTSW 2 37202082 nonsense probably null
R4608:Olfr365 UTSW 2 37202082 nonsense probably null
R4889:Olfr365 UTSW 2 37202045 missense probably damaging 1.00
R5398:Olfr365 UTSW 2 37201318 missense probably benign 0.33
R5560:Olfr365 UTSW 2 37201930 missense probably benign 0.01
R5670:Olfr365 UTSW 2 37201994 missense probably benign 0.19
R6108:Olfr365 UTSW 2 37201766 missense possibly damaging 0.68
R6727:Olfr365 UTSW 2 37202106 missense probably damaging 1.00
R6860:Olfr365 UTSW 2 37202177 missense possibly damaging 0.96
R7079:Olfr365 UTSW 2 37202173 missense probably benign 0.00
R7113:Olfr365 UTSW 2 37201556 missense possibly damaging 0.74
R7278:Olfr365 UTSW 2 37202080 missense probably damaging 1.00
R7731:Olfr365 UTSW 2 37201549 missense probably benign 0.07
R8096:Olfr365 UTSW 2 37202066 missense probably damaging 0.99
R9180:Olfr365 UTSW 2 37201280 missense probably benign
R9301:Olfr365 UTSW 2 37201243 start codon destroyed probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCATCCGCTCTGATTCCAGG -3'
(R):5'- AACACAGGCTGAGTATCACAG -3'

Sequencing Primer
(F):5'- TGATTCCAGGCTCCATACACC -3'
(R):5'- TGCTTAATGACATGGGAAGCAC -3'
Posted On 2015-07-06