Incidental Mutation 'R4375:Strc'
ID325059
Institutional Source Beutler Lab
Gene Symbol Strc
Ensembl Gene ENSMUSG00000033498
Gene Namestereocilin
SynonymsDFNB16
MMRRC Submission 041119-MU
Accession Numbers

Genbank: NM_080459; MGI: 2153816

Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R4375 (G1)
Quality Score195
Status Validated
Chromosome2
Chromosomal Location121363728-121387168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121380823 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 14 (S14P)
Ref Sequence ENSEMBL: ENSMUSP00000039378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038389]
Predicted Effect unknown
Transcript: ENSMUST00000038389
AA Change: S14P
SMART Domains Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: S14P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 74 87 N/A INTRINSIC
low complexity region 108 119 N/A INTRINSIC
low complexity region 132 161 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
low complexity region 376 425 N/A INTRINSIC
low complexity region 610 635 N/A INTRINSIC
low complexity region 656 677 N/A INTRINSIC
low complexity region 728 746 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1168 1194 N/A INTRINSIC
low complexity region 1287 1302 N/A INTRINSIC
low complexity region 1560 1580 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149219
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adhfe1 A T 1: 9,561,628 probably benign Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cntnap1 A G 11: 101,182,253 D561G probably damaging Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Cyp4b1 T C 4: 115,636,313 T191A probably benign Het
Dapk1 A T 13: 60,761,589 M1339L probably benign Het
Dpm3 T C 3: 89,266,908 Y59H probably damaging Het
Eif2ak4 A G 2: 118,427,924 Y585C probably damaging Het
Ercc1 G A 7: 19,347,132 probably benign Het
Fam184b T C 5: 45,542,343 D577G probably benign Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Hsf2bp C T 17: 31,987,348 D270N probably null Het
Lactbl1 T C 4: 136,637,591 V418A possibly damaging Het
Lifr A T 15: 7,166,898 M188L probably benign Het
Ltbp1 G T 17: 75,312,997 G760V probably damaging Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Nlrp12 A G 7: 3,240,946 L312P possibly damaging Het
Olfr365 T A 2: 37,201,562 M107K probably benign Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Olfr898 T C 9: 38,349,169 F23L probably benign Het
Pcdh17 T C 14: 84,448,271 V726A possibly damaging Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Phf20l1 T C 15: 66,615,222 S369P probably benign Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Proser3 A G 7: 30,540,671 V336A possibly damaging Het
Rbbp8 C T 18: 11,725,410 T646M probably benign Het
Rgs1 T C 1: 144,247,906 T94A probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Snx9 G A 17: 5,908,626 W292* probably null Het
St14 T C 9: 31,090,458 I784V probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Ubap1 G A 4: 41,371,850 probably null Het
Zfr T C 15: 12,118,340 probably null Het
Other mutations in Strc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Strc APN 2 121365060 missense probably benign 0.39
IGL01152:Strc APN 2 121370795 missense probably benign
IGL01608:Strc APN 2 121375594 missense probably benign 0.05
IGL01695:Strc APN 2 121375298 missense probably damaging 1.00
IGL01715:Strc APN 2 121365737 splice site probably null
IGL01906:Strc APN 2 121377634 missense probably benign
IGL02135:Strc APN 2 121364834 missense probably damaging 1.00
IGL02416:Strc APN 2 121369058 missense probably damaging 1.00
IGL02455:Strc APN 2 121375791 unclassified probably benign
IGL03029:Strc APN 2 121364044 missense possibly damaging 0.95
IGL03176:Strc APN 2 121372180 missense probably damaging 0.99
IGL03272:Strc APN 2 121371751 missense probably damaging 1.00
3-1:Strc UTSW 2 121373680 missense probably damaging 0.99
IGL02799:Strc UTSW 2 121379236 missense probably damaging 1.00
PIT4283001:Strc UTSW 2 121375307 missense probably damaging 1.00
R0022:Strc UTSW 2 121368393 missense probably damaging 1.00
R0494:Strc UTSW 2 121379533 missense probably damaging 0.99
R1065:Strc UTSW 2 121366651 missense probably damaging 1.00
R1148:Strc UTSW 2 121372077 intron probably benign
R1148:Strc UTSW 2 121372077 intron probably benign
R1203:Strc UTSW 2 121372123 missense possibly damaging 0.66
R1343:Strc UTSW 2 121365115 missense probably benign 0.21
R1544:Strc UTSW 2 121372738 splice site probably null
R1650:Strc UTSW 2 121380885 start gained probably benign
R1840:Strc UTSW 2 121379296 missense probably damaging 1.00
R1983:Strc UTSW 2 121371037 missense possibly damaging 0.54
R2035:Strc UTSW 2 121374934 missense probably damaging 1.00
R2058:Strc UTSW 2 121378887 missense probably damaging 1.00
R2158:Strc UTSW 2 121365862 missense probably benign 0.10
R2219:Strc UTSW 2 121364523 missense probably damaging 1.00
R2680:Strc UTSW 2 121365111 missense probably damaging 0.99
R4563:Strc UTSW 2 121365805 missense probably benign 0.02
R4578:Strc UTSW 2 121378003 missense possibly damaging 0.94
R4607:Strc UTSW 2 121372945 missense probably benign 0.31
R4651:Strc UTSW 2 121374348 missense possibly damaging 0.67
R4652:Strc UTSW 2 121374348 missense possibly damaging 0.67
R4790:Strc UTSW 2 121375594 missense probably benign 0.05
R5480:Strc UTSW 2 121364819 missense probably benign 0.00
R5580:Strc UTSW 2 121375012 missense probably damaging 0.99
R5679:Strc UTSW 2 121368100 missense probably benign 0.03
R5703:Strc UTSW 2 121370814 missense probably benign
R5841:Strc UTSW 2 121365877 missense probably benign 0.29
R5917:Strc UTSW 2 121379309 missense probably benign
R5958:Strc UTSW 2 121376922 missense possibly damaging 0.56
R6320:Strc UTSW 2 121374958 missense probably benign 0.16
R6619:Strc UTSW 2 121368432 missense probably damaging 0.99
R6695:Strc UTSW 2 121377224 missense probably benign 0.35
R6970:Strc UTSW 2 121378014 missense probably benign 0.41
R7018:Strc UTSW 2 121369058 missense probably damaging 1.00
R7045:Strc UTSW 2 121370726 missense probably damaging 1.00
R7190:Strc UTSW 2 121369026 missense probably benign 0.14
R7283:Strc UTSW 2 121379452 missense probably damaging 0.99
R7694:Strc UTSW 2 121377096 missense probably damaging 1.00
R7699:Strc UTSW 2 121371748 missense possibly damaging 0.47
R7700:Strc UTSW 2 121371748 missense possibly damaging 0.47
R7756:Strc UTSW 2 121370946 missense probably benign
R7758:Strc UTSW 2 121370946 missense probably benign
R7822:Strc UTSW 2 121377738 missense probably benign 0.01
R7830:Strc UTSW 2 121375049 missense probably damaging 0.99
R7953:Strc UTSW 2 121377363 missense probably damaging 0.99
R8137:Strc UTSW 2 121366738 missense probably damaging 0.98
R8394:Strc UTSW 2 121379009 missense probably benign 0.00
R8427:Strc UTSW 2 121377531 missense probably damaging 1.00
Z1176:Strc UTSW 2 121375521 missense probably damaging 0.98
Z1176:Strc UTSW 2 121379044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCAGTTTTAAAAGGAGGGC -3'
(R):5'- TTTCCTGAGAGACCACACGAC -3'

Sequencing Primer
(F):5'- GTTCAATTCCCAGCAACTACATGGTG -3'
(R):5'- CGACAGTGTCAGAGGAACCC -3'
Posted On2015-07-06