Incidental Mutation 'R4375:Rpl11'
ID 325065
Institutional Source Beutler Lab
Gene Symbol Rpl11
Ensembl Gene ENSMUSG00000059291
Gene Name ribosomal protein L11
Synonyms
MMRRC Submission 041119-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock # R4375 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 136028265-136053428 bp(-) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) G to A at 136051143 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102536] [ENSMUST00000155873]
AlphaFold Q9CXW4
Predicted Effect probably benign
Transcript: ENSMUST00000102536
SMART Domains Protein: ENSMUSP00000099595
Gene: ENSMUSG00000059291

DomainStartEndE-ValueType
Pfam:Ribosomal_L5 10 63 6.9e-23 PFAM
Pfam:Ribosomal_L5_C 67 166 9.5e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142440
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150565
Predicted Effect probably benign
Transcript: ENSMUST00000155873
SMART Domains Protein: ENSMUSP00000121108
Gene: ENSMUSG00000059291

DomainStartEndE-ValueType
Pfam:Ribosomal_L5 13 66 8e-23 PFAM
Pfam:Ribosomal_L5_C 70 169 1.1e-26 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L5P family of ribosomal proteins. It is located in the cytoplasm. The protein probably associates with the 5S rRNA. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adhfe1 A T 1: 9,561,628 probably benign Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cntnap1 A G 11: 101,182,253 D561G probably damaging Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Cyp4b1 T C 4: 115,636,313 T191A probably benign Het
Dapk1 A T 13: 60,761,589 M1339L probably benign Het
Dpm3 T C 3: 89,266,908 Y59H probably damaging Het
Eif2ak4 A G 2: 118,427,924 Y585C probably damaging Het
Ercc1 G A 7: 19,347,132 probably benign Het
Fam184b T C 5: 45,542,343 D577G probably benign Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Hsf2bp C T 17: 31,987,348 D270N probably null Het
Lactbl1 T C 4: 136,637,591 V418A possibly damaging Het
Lifr A T 15: 7,166,898 M188L probably benign Het
Ltbp1 G T 17: 75,312,997 G760V probably damaging Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Nlrp12 A G 7: 3,240,946 L312P possibly damaging Het
Olfr365 T A 2: 37,201,562 M107K probably benign Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Olfr898 T C 9: 38,349,169 F23L probably benign Het
Pcdh17 T C 14: 84,448,271 V726A possibly damaging Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Phf20l1 T C 15: 66,615,222 S369P probably benign Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Proser3 A G 7: 30,540,671 V336A possibly damaging Het
Rbbp8 C T 18: 11,725,410 T646M probably benign Het
Rgs1 T C 1: 144,247,906 T94A probably benign Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Snx9 G A 17: 5,908,626 W292* probably null Het
St14 T C 9: 31,090,458 I784V probably benign Het
Strc A G 2: 121,380,823 S14P unknown Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Ubap1 G A 4: 41,371,850 probably null Het
Zfr T C 15: 12,118,340 probably null Het
Other mutations in Rpl11
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4373:Rpl11 UTSW 4 136051143 intron probably benign
R4374:Rpl11 UTSW 4 136051143 intron probably benign
R4377:Rpl11 UTSW 4 136051143 intron probably benign
R4560:Rpl11 UTSW 4 136051211 missense probably damaging 1.00
R4781:Rpl11 UTSW 4 136050288 missense probably benign 0.00
R5541:Rpl11 UTSW 4 136052732 splice site probably benign
R8186:Rpl11 UTSW 4 136051657 missense possibly damaging 0.86
R9087:Rpl11 UTSW 4 136052689 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- AAATGCAGCCCAGGATGACC -3'
(R):5'- GTTGGGCTACTTGAACATGATG -3'

Sequencing Primer
(F):5'- ATGACCCAGAGAGCTTTGC -3'
(R):5'- CATGATGGATAGCATGGTCACTTC -3'
Posted On 2015-07-06