Incidental Mutation 'R4375:Olfr608'
ID 325071
Institutional Source Beutler Lab
Gene Symbol Olfr608
Ensembl Gene ENSMUSG00000073948
Gene Name olfactory receptor 608
Synonyms GA_x6K02T2PBJ9-6191595-6192545, MOR26-3
MMRRC Submission 041119-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock # R4375 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 103469877-103471358 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103470071 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 11 (S11P)
Ref Sequence ENSEMBL: ENSMUSP00000150595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000213546]
AlphaFold E9Q564
Predicted Effect probably damaging
Transcript: ENSMUST00000098199
AA Change: S11P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095801
Gene: ENSMUSG00000073948
AA Change: S11P

DomainStartEndE-ValueType
Pfam:7tm_4 32 311 4.7e-101 PFAM
Pfam:7TM_GPCR_Srsx 36 308 7.1e-8 PFAM
Pfam:7tm_1 42 293 6.4e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213546
AA Change: S11P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adhfe1 A T 1: 9,561,628 probably benign Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cntnap1 A G 11: 101,182,253 D561G probably damaging Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Cyp4b1 T C 4: 115,636,313 T191A probably benign Het
Dapk1 A T 13: 60,761,589 M1339L probably benign Het
Dpm3 T C 3: 89,266,908 Y59H probably damaging Het
Eif2ak4 A G 2: 118,427,924 Y585C probably damaging Het
Ercc1 G A 7: 19,347,132 probably benign Het
Fam184b T C 5: 45,542,343 D577G probably benign Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Hsf2bp C T 17: 31,987,348 D270N probably null Het
Lactbl1 T C 4: 136,637,591 V418A possibly damaging Het
Lifr A T 15: 7,166,898 M188L probably benign Het
Ltbp1 G T 17: 75,312,997 G760V probably damaging Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Nlrp12 A G 7: 3,240,946 L312P possibly damaging Het
Olfr365 T A 2: 37,201,562 M107K probably benign Het
Olfr898 T C 9: 38,349,169 F23L probably benign Het
Pcdh17 T C 14: 84,448,271 V726A possibly damaging Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Phf20l1 T C 15: 66,615,222 S369P probably benign Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Proser3 A G 7: 30,540,671 V336A possibly damaging Het
Rbbp8 C T 18: 11,725,410 T646M probably benign Het
Rgs1 T C 1: 144,247,906 T94A probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Snx9 G A 17: 5,908,626 W292* probably null Het
St14 T C 9: 31,090,458 I784V probably benign Het
Strc A G 2: 121,380,823 S14P unknown Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Ubap1 G A 4: 41,371,850 probably null Het
Zfr T C 15: 12,118,340 probably null Het
Other mutations in Olfr608
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01735:Olfr608 APN 7 103470323 missense probably damaging 1.00
IGL02428:Olfr608 APN 7 103470383 missense probably benign 0.03
IGL02832:Olfr608 APN 7 103470698 missense probably benign 0.00
R0546:Olfr608 UTSW 7 103470700 missense possibly damaging 0.65
R1518:Olfr608 UTSW 7 103470042 start codon destroyed probably null 0.98
R1696:Olfr608 UTSW 7 103470177 missense probably benign 0.18
R1735:Olfr608 UTSW 7 103470146 missense possibly damaging 0.83
R2927:Olfr608 UTSW 7 103470882 missense probably damaging 1.00
R3856:Olfr608 UTSW 7 103470660 missense probably damaging 1.00
R4374:Olfr608 UTSW 7 103470071 missense probably damaging 0.97
R4377:Olfr608 UTSW 7 103470071 missense probably damaging 0.97
R5059:Olfr608 UTSW 7 103470281 nonsense probably null
R5174:Olfr608 UTSW 7 103470403 missense probably benign 0.14
R5579:Olfr608 UTSW 7 103470914 missense probably damaging 1.00
R6762:Olfr608 UTSW 7 103470389 missense probably benign 0.02
R7888:Olfr608 UTSW 7 103470799 nonsense probably null
R7980:Olfr608 UTSW 7 103470297 missense probably damaging 1.00
R8150:Olfr608 UTSW 7 103470252 missense probably damaging 1.00
R8966:Olfr608 UTSW 7 103470317 missense probably benign 0.07
R9369:Olfr608 UTSW 7 103470348 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CTGCTGCACAGGATGACATTTTG -3'
(R):5'- AGCATTTTCAGGGACGTGGAAC -3'

Sequencing Primer
(F):5'- CTGCACAGGATGACATTTTGGAAAC -3'
(R):5'- GAATGTCATTCATTGCCAACATGC -3'
Posted On 2015-07-06