Incidental Mutation 'R4375:St14'
ID 325073
Institutional Source Beutler Lab
Gene Symbol St14
Ensembl Gene ENSMUSG00000031995
Gene Name suppression of tumorigenicity 14 (colon carcinoma)
Synonyms Tmprss14, matriptase, Prss14, Epithin, MT-SP1
MMRRC Submission 041119-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4375 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 31000698-31043149 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 31001754 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 784 (I784V)
Ref Sequence ENSEMBL: ENSMUSP00000034478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034478]
AlphaFold P56677
Predicted Effect probably benign
Transcript: ENSMUST00000034478
AA Change: I784V

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000034478
Gene: ENSMUSG00000031995
AA Change: I784V

DomainStartEndE-ValueType
transmembrane domain 55 77 N/A INTRINSIC
Pfam:SEA 88 181 7.9e-17 PFAM
CUB 214 334 4.24e-14 SMART
CUB 340 447 4.37e-25 SMART
LDLa 452 486 2.31e-9 SMART
LDLa 487 523 4.08e-10 SMART
LDLa 524 561 3.98e-13 SMART
LDLa 566 604 1.48e-7 SMART
Tryp_SPc 614 849 1.25e-93 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119589
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial-derived, integral membrane serine protease. This protease forms a complex with the Kunitz-type serine protease inhibitor, HAI-1, and is found to be activated by sphingosine 1-phosphate. This protease has been shown to cleave and activate hepatocyte growth factor/scattering factor, and urokinase plasminogen activator, which suggest the function of this protease as an epithelial membrane activator for other proteases and latent growth factors. The expression of this protease has been associated with breast, colon, prostate, and ovarian tumors, which implicates its role in cancer invasion, and metastasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this locus results in pleiotropic defects affecting the development of the epidermis, hair follicles, and immune system. Mutant mice become dehydrated due to impaired epidermal barrier function and die within days of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adhfe1 A T 1: 9,631,853 (GRCm39) probably benign Het
Cd209c T C 8: 4,004,635 (GRCm39) noncoding transcript Het
Cntnap1 A G 11: 101,073,079 (GRCm39) D561G probably damaging Het
Csf1 T A 3: 107,664,055 (GRCm39) T38S probably damaging Het
Cyp4b1 T C 4: 115,493,510 (GRCm39) T191A probably benign Het
Dapk1 A T 13: 60,909,403 (GRCm39) M1339L probably benign Het
Dpm3 T C 3: 89,174,215 (GRCm39) Y59H probably damaging Het
Eif2ak4 A G 2: 118,258,405 (GRCm39) Y585C probably damaging Het
Ercc1 G A 7: 19,081,057 (GRCm39) probably benign Het
Fam184b T C 5: 45,699,685 (GRCm39) D577G probably benign Het
Gon4l C A 3: 88,814,694 (GRCm39) P1888T probably benign Het
Hsf2bp C T 17: 32,206,322 (GRCm39) D270N probably null Het
Lactbl1 T C 4: 136,364,902 (GRCm39) V418A possibly damaging Het
Lifr A T 15: 7,196,379 (GRCm39) M188L probably benign Het
Ltbp1 G T 17: 75,619,992 (GRCm39) G760V probably damaging Het
Marchf11 A G 15: 26,309,532 (GRCm39) E62G probably damaging Het
Nlrp12 A G 7: 3,289,576 (GRCm39) L312P possibly damaging Het
Or1l4 T A 2: 37,091,574 (GRCm39) M107K probably benign Het
Or52ae7 T C 7: 103,119,278 (GRCm39) S11P probably damaging Het
Or8c20 T C 9: 38,260,465 (GRCm39) F23L probably benign Het
Pcdh17 T C 14: 84,685,711 (GRCm39) V726A possibly damaging Het
Pdia4 G A 6: 47,775,326 (GRCm39) R495W probably damaging Het
Phf20l1 T C 15: 66,487,071 (GRCm39) S369P probably benign Het
Polq G T 16: 36,833,543 (GRCm39) V79F probably damaging Het
Prcc A G 3: 87,774,714 (GRCm39) Y363H probably damaging Het
Proser3 A G 7: 30,240,096 (GRCm39) V336A possibly damaging Het
Rbbp8 C T 18: 11,858,467 (GRCm39) T646M probably benign Het
Rgs1 T C 1: 144,123,644 (GRCm39) T94A probably benign Het
Rpl11 G A 4: 135,778,454 (GRCm39) probably benign Het
Slc14a2 G A 18: 78,250,283 (GRCm39) R62C probably damaging Het
Snx9 G A 17: 5,958,901 (GRCm39) W292* probably null Het
Steep1 C A X: 36,087,812 (GRCm39) C206F probably benign Het
Strc A G 2: 121,211,304 (GRCm39) S14P unknown Het
Ttc23l CT CTTGGATT 15: 10,537,648 (GRCm39) probably benign Het
Ttc23l G A 15: 10,537,652 (GRCm39) S206L probably benign Het
Ubap1 G A 4: 41,371,850 (GRCm39) probably null Het
Zfr T C 15: 12,118,426 (GRCm39) probably null Het
Other mutations in St14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:St14 APN 9 31,015,075 (GRCm39) missense probably damaging 1.00
IGL01443:St14 APN 9 31,011,489 (GRCm39) nonsense probably null
IGL01816:St14 APN 9 31,019,563 (GRCm39) missense possibly damaging 0.71
IGL02100:St14 APN 9 31,011,426 (GRCm39) splice site probably benign
IGL02494:St14 APN 9 31,019,941 (GRCm39) missense possibly damaging 0.47
IGL02588:St14 APN 9 31,001,329 (GRCm39) splice site probably benign
IGL02663:St14 APN 9 31,011,678 (GRCm39) splice site probably null
IGL02711:St14 APN 9 31,001,196 (GRCm39) missense probably benign 0.05
IGL03130:St14 APN 9 31,008,367 (GRCm39) critical splice donor site probably null
IGL03296:St14 APN 9 31,020,008 (GRCm39) missense probably damaging 0.98
IGL03400:St14 APN 9 31,008,267 (GRCm39) splice site probably benign
R0101:St14 UTSW 9 31,008,403 (GRCm39) missense probably benign 0.23
R0225:St14 UTSW 9 31,019,580 (GRCm39) critical splice acceptor site probably null
R0335:St14 UTSW 9 31,002,620 (GRCm39) splice site probably benign
R0892:St14 UTSW 9 31,011,724 (GRCm39) missense probably benign 0.38
R1334:St14 UTSW 9 31,019,506 (GRCm39) missense probably damaging 1.00
R1487:St14 UTSW 9 31,008,476 (GRCm39) missense probably damaging 1.00
R1521:St14 UTSW 9 31,019,511 (GRCm39) missense probably benign 0.03
R1782:St14 UTSW 9 31,011,460 (GRCm39) missense probably damaging 1.00
R1920:St14 UTSW 9 31,001,166 (GRCm39) missense possibly damaging 0.94
R1921:St14 UTSW 9 31,001,166 (GRCm39) missense possibly damaging 0.94
R1922:St14 UTSW 9 31,001,166 (GRCm39) missense possibly damaging 0.94
R1933:St14 UTSW 9 31,017,508 (GRCm39) missense probably benign 0.00
R2070:St14 UTSW 9 31,002,669 (GRCm39) missense probably damaging 1.00
R2411:St14 UTSW 9 31,019,530 (GRCm39) missense probably benign 0.13
R4152:St14 UTSW 9 31,001,802 (GRCm39) missense probably benign 0.08
R4419:St14 UTSW 9 31,008,224 (GRCm39) missense probably damaging 1.00
R4747:St14 UTSW 9 31,015,053 (GRCm39) missense possibly damaging 0.78
R4791:St14 UTSW 9 31,006,918 (GRCm39) missense probably benign 0.27
R4915:St14 UTSW 9 31,019,960 (GRCm39) nonsense probably null
R5056:St14 UTSW 9 31,008,847 (GRCm39) splice site probably null
R5134:St14 UTSW 9 31,006,879 (GRCm39) missense probably benign 0.00
R5241:St14 UTSW 9 31,011,714 (GRCm39) nonsense probably null
R5325:St14 UTSW 9 31,008,274 (GRCm39) splice site probably null
R5644:St14 UTSW 9 31,017,806 (GRCm39) missense probably benign
R5828:St14 UTSW 9 31,002,803 (GRCm39) missense probably damaging 1.00
R5922:St14 UTSW 9 31,041,200 (GRCm39) intron probably benign
R5930:St14 UTSW 9 31,015,056 (GRCm39) missense probably damaging 1.00
R5963:St14 UTSW 9 31,017,853 (GRCm39) intron probably benign
R6911:St14 UTSW 9 31,018,081 (GRCm39) missense probably benign 0.00
R6937:St14 UTSW 9 31,040,956 (GRCm39) splice site probably null
R6986:St14 UTSW 9 31,007,845 (GRCm39) missense probably damaging 0.98
R7226:St14 UTSW 9 31,011,448 (GRCm39) missense possibly damaging 0.63
R7395:St14 UTSW 9 31,008,195 (GRCm39) missense probably benign 0.29
R7400:St14 UTSW 9 31,019,571 (GRCm39) missense probably benign 0.36
R8194:St14 UTSW 9 31,042,921 (GRCm39) start codon destroyed probably null 0.95
R8886:St14 UTSW 9 31,008,420 (GRCm39) missense possibly damaging 0.93
R9248:St14 UTSW 9 31,002,905 (GRCm39) missense probably damaging 1.00
R9440:St14 UTSW 9 31,007,845 (GRCm39) missense probably damaging 0.98
Z1177:St14 UTSW 9 31,001,803 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGCATGACTTCCCCAGGAC -3'
(R):5'- AACCTGACCAGTGAGGATTATCTC -3'

Sequencing Primer
(F):5'- AGCTCCGGCCTAGTTAGC -3'
(R):5'- GATTATCTCCAGTGCGGGTTTTCC -3'
Posted On 2015-07-06