Incidental Mutation 'R4375:Lifr'
ID 325078
Institutional Source Beutler Lab
Gene Symbol Lifr
Ensembl Gene ENSMUSG00000054263
Gene Name LIF receptor alpha
Synonyms soluble differentiation-stimulating factor receptor, A230075M04Rik
MMRRC Submission 041119-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4375 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 7120095-7226970 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 7196379 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 188 (M188L)
Ref Sequence ENSEMBL: ENSMUSP00000154181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067190] [ENSMUST00000164529] [ENSMUST00000171588] [ENSMUST00000226471] [ENSMUST00000226934] [ENSMUST00000227727] [ENSMUST00000228723]
AlphaFold P42703
Predicted Effect probably benign
Transcript: ENSMUST00000067190
AA Change: M188L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064551
Gene: ENSMUSG00000054263
AA Change: M188L

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 5e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
FN3 719 815 4.81e-4 SMART
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164529
AA Change: M188L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131434
Gene: ENSMUSG00000054263
AA Change: M188L

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 4e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171588
AA Change: M188L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126137
Gene: ENSMUSG00000054263
AA Change: M188L

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 5e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
FN3 719 815 4.81e-4 SMART
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226471
AA Change: M188L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000226934
AA Change: M188L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000227727
AA Change: M188L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000228723
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the type I cytokine receptor family. This protein combines with a high-affinity converter subunit, gp130, to form a receptor complex that mediates the action of the leukemia inhibitory factor, a polyfunctional cytokine that is involved in cellular differentiation, proliferation and survival in the adult and the embryo. Mutations in this gene cause Schwartz-Jampel syndrome type 2, a disease belonging to the group of the bent-bone dysplasias. A translocation that involves the promoter of this gene, t(5;8)(p13;q12) with the pleiomorphic adenoma gene 1, is associated with salivary gland pleiomorphic adenoma, a common type of benign epithelial tumor of the salivary gland. Multiple splice variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die as neonates with reduced numbers of facial and spinal motor neurons, neurons of the nucleus ambiguus, and astrocytes. Mutants also show impaired placentation, severe osteopenia, and low hepatic glycogen stores. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(19)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adhfe1 A T 1: 9,631,853 (GRCm39) probably benign Het
Cd209c T C 8: 4,004,635 (GRCm39) noncoding transcript Het
Cntnap1 A G 11: 101,073,079 (GRCm39) D561G probably damaging Het
Csf1 T A 3: 107,664,055 (GRCm39) T38S probably damaging Het
Cyp4b1 T C 4: 115,493,510 (GRCm39) T191A probably benign Het
Dapk1 A T 13: 60,909,403 (GRCm39) M1339L probably benign Het
Dpm3 T C 3: 89,174,215 (GRCm39) Y59H probably damaging Het
Eif2ak4 A G 2: 118,258,405 (GRCm39) Y585C probably damaging Het
Ercc1 G A 7: 19,081,057 (GRCm39) probably benign Het
Fam184b T C 5: 45,699,685 (GRCm39) D577G probably benign Het
Gon4l C A 3: 88,814,694 (GRCm39) P1888T probably benign Het
Hsf2bp C T 17: 32,206,322 (GRCm39) D270N probably null Het
Lactbl1 T C 4: 136,364,902 (GRCm39) V418A possibly damaging Het
Ltbp1 G T 17: 75,619,992 (GRCm39) G760V probably damaging Het
Marchf11 A G 15: 26,309,532 (GRCm39) E62G probably damaging Het
Nlrp12 A G 7: 3,289,576 (GRCm39) L312P possibly damaging Het
Or1l4 T A 2: 37,091,574 (GRCm39) M107K probably benign Het
Or52ae7 T C 7: 103,119,278 (GRCm39) S11P probably damaging Het
Or8c20 T C 9: 38,260,465 (GRCm39) F23L probably benign Het
Pcdh17 T C 14: 84,685,711 (GRCm39) V726A possibly damaging Het
Pdia4 G A 6: 47,775,326 (GRCm39) R495W probably damaging Het
Phf20l1 T C 15: 66,487,071 (GRCm39) S369P probably benign Het
Polq G T 16: 36,833,543 (GRCm39) V79F probably damaging Het
Prcc A G 3: 87,774,714 (GRCm39) Y363H probably damaging Het
Proser3 A G 7: 30,240,096 (GRCm39) V336A possibly damaging Het
Rbbp8 C T 18: 11,858,467 (GRCm39) T646M probably benign Het
Rgs1 T C 1: 144,123,644 (GRCm39) T94A probably benign Het
Rpl11 G A 4: 135,778,454 (GRCm39) probably benign Het
Slc14a2 G A 18: 78,250,283 (GRCm39) R62C probably damaging Het
Snx9 G A 17: 5,958,901 (GRCm39) W292* probably null Het
St14 T C 9: 31,001,754 (GRCm39) I784V probably benign Het
Steep1 C A X: 36,087,812 (GRCm39) C206F probably benign Het
Strc A G 2: 121,211,304 (GRCm39) S14P unknown Het
Ttc23l CT CTTGGATT 15: 10,537,648 (GRCm39) probably benign Het
Ttc23l G A 15: 10,537,652 (GRCm39) S206L probably benign Het
Ubap1 G A 4: 41,371,850 (GRCm39) probably null Het
Zfr T C 15: 12,118,426 (GRCm39) probably null Het
Other mutations in Lifr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Lifr APN 15 7,215,220 (GRCm39) splice site probably null
IGL01470:Lifr APN 15 7,205,147 (GRCm39) nonsense probably null
IGL01489:Lifr APN 15 7,205,037 (GRCm39) splice site probably benign
IGL01619:Lifr APN 15 7,220,643 (GRCm39) missense probably damaging 1.00
IGL01636:Lifr APN 15 7,208,499 (GRCm39) splice site probably benign
IGL01943:Lifr APN 15 7,217,630 (GRCm39) missense probably damaging 1.00
IGL02253:Lifr APN 15 7,220,085 (GRCm39) missense probably damaging 1.00
IGL02355:Lifr APN 15 7,194,174 (GRCm39) critical splice donor site probably null
IGL02362:Lifr APN 15 7,194,174 (GRCm39) critical splice donor site probably null
IGL02450:Lifr APN 15 7,220,246 (GRCm39) missense probably damaging 1.00
IGL02477:Lifr APN 15 7,216,404 (GRCm39) missense probably damaging 1.00
IGL02503:Lifr APN 15 7,215,104 (GRCm39) missense probably damaging 1.00
IGL02571:Lifr APN 15 7,219,592 (GRCm39) unclassified probably benign
IGL03340:Lifr APN 15 7,207,417 (GRCm39) missense probably benign 0.02
N/A - 535:Lifr UTSW 15 7,216,434 (GRCm39) missense possibly damaging 0.80
R0012:Lifr UTSW 15 7,205,089 (GRCm39) missense possibly damaging 0.78
R0015:Lifr UTSW 15 7,217,667 (GRCm39) splice site probably null
R0102:Lifr UTSW 15 7,208,373 (GRCm39) missense probably damaging 0.98
R0102:Lifr UTSW 15 7,208,373 (GRCm39) missense probably damaging 0.98
R0305:Lifr UTSW 15 7,206,982 (GRCm39) missense probably damaging 0.99
R0416:Lifr UTSW 15 7,196,395 (GRCm39) missense probably damaging 1.00
R0440:Lifr UTSW 15 7,186,672 (GRCm39) nonsense probably null
R0519:Lifr UTSW 15 7,207,061 (GRCm39) missense probably damaging 1.00
R0595:Lifr UTSW 15 7,206,950 (GRCm39) missense probably damaging 1.00
R0601:Lifr UTSW 15 7,198,753 (GRCm39) splice site probably null
R0780:Lifr UTSW 15 7,206,947 (GRCm39) missense probably benign 0.00
R0790:Lifr UTSW 15 7,215,196 (GRCm39) missense probably benign 0.13
R1376:Lifr UTSW 15 7,214,245 (GRCm39) missense probably benign 0.04
R1376:Lifr UTSW 15 7,214,245 (GRCm39) missense probably benign 0.04
R1400:Lifr UTSW 15 7,220,346 (GRCm39) missense probably benign 0.04
R1498:Lifr UTSW 15 7,220,099 (GRCm39) missense probably damaging 0.99
R1785:Lifr UTSW 15 7,211,337 (GRCm39) missense possibly damaging 0.89
R1786:Lifr UTSW 15 7,211,337 (GRCm39) missense possibly damaging 0.89
R1906:Lifr UTSW 15 7,217,612 (GRCm39) missense probably damaging 0.98
R2099:Lifr UTSW 15 7,186,732 (GRCm39) missense probably benign
R2102:Lifr UTSW 15 7,216,404 (GRCm39) missense probably damaging 1.00
R2136:Lifr UTSW 15 7,211,338 (GRCm39) missense possibly damaging 0.89
R2511:Lifr UTSW 15 7,196,397 (GRCm39) missense probably benign
R4883:Lifr UTSW 15 7,215,106 (GRCm39) missense possibly damaging 0.94
R5681:Lifr UTSW 15 7,220,565 (GRCm39) missense probably damaging 1.00
R5689:Lifr UTSW 15 7,214,285 (GRCm39) missense probably damaging 1.00
R5693:Lifr UTSW 15 7,205,041 (GRCm39) missense probably damaging 1.00
R5902:Lifr UTSW 15 7,220,231 (GRCm39) missense probably benign
R5918:Lifr UTSW 15 7,188,897 (GRCm39) missense probably benign 0.00
R5924:Lifr UTSW 15 7,202,453 (GRCm39) missense probably benign 0.28
R6037:Lifr UTSW 15 7,216,424 (GRCm39) missense probably damaging 1.00
R6037:Lifr UTSW 15 7,216,424 (GRCm39) missense probably damaging 1.00
R6289:Lifr UTSW 15 7,196,391 (GRCm39) missense probably benign 0.00
R6339:Lifr UTSW 15 7,196,530 (GRCm39) missense probably benign 0.01
R6860:Lifr UTSW 15 7,202,418 (GRCm39) missense probably benign 0.02
R7106:Lifr UTSW 15 7,202,405 (GRCm39) missense probably benign 0.02
R7107:Lifr UTSW 15 7,208,421 (GRCm39) missense possibly damaging 0.88
R7274:Lifr UTSW 15 7,196,540 (GRCm39) critical splice donor site probably null
R7625:Lifr UTSW 15 7,198,723 (GRCm39) missense probably damaging 0.99
R7631:Lifr UTSW 15 7,214,258 (GRCm39) missense probably damaging 1.00
R7958:Lifr UTSW 15 7,211,478 (GRCm39) missense possibly damaging 0.62
R7991:Lifr UTSW 15 7,202,963 (GRCm39) missense possibly damaging 0.79
R8175:Lifr UTSW 15 7,216,496 (GRCm39) missense probably damaging 1.00
R8427:Lifr UTSW 15 7,220,462 (GRCm39) missense probably benign 0.01
R9274:Lifr UTSW 15 7,217,591 (GRCm39) missense probably damaging 0.98
R9311:Lifr UTSW 15 7,208,418 (GRCm39) missense possibly damaging 0.47
R9365:Lifr UTSW 15 7,198,521 (GRCm39) missense probably damaging 1.00
R9509:Lifr UTSW 15 7,188,955 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGACCGTTGTACAGTGGTGC -3'
(R):5'- TGGGCATATACCAACCCTTAC -3'

Sequencing Primer
(F):5'- ACAGTGGTGCGGATCATTTTCC -3'
(R):5'- CTTAAGCAATCTAGCCCATGTG -3'
Posted On 2015-07-06