Mutagenetix > Incidental Mutations

Incidental Mutation 'R4375:Ttc23l'

325080

Institutional Source

Beutler Lab

Gene Symbol

Ttc23l

Ensembl Gene

ENSMUSG00000022249

Gene Name

tetratricopeptide repeat domain 23-like

Synonyms

4930401A09Rik

MMRRC Submission

041119-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.070) question?

Stock #

R4375 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

10500102-10558668 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 10537566 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 206 (S206L)

Ref Sequence

ENSEMBL: ENSMUSP00000155921 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022857] [ENSMUST00000166039] [ENSMUST00000167842] [ENSMUST00000167842]

AlphaFold

A6H6E9

Predicted Effect

probably benign
Transcript: ENSMUST00000022857
AA Change: S206L

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000022857
Gene: ENSMUSG00000022249
AA Change: S206L

Domain	Start	End	E-Value	Type
TPR	159	192	4.21e1	SMART
Blast:TPR	208	239	2e-6	BLAST
TPR	250	283	1.4e1	SMART
low complexity region	292	303	N/A	INTRINSIC
TPR	376	409	9.53e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166039

SMART Domains

Protein: ENSMUSP00000131180
Gene: ENSMUSG00000022249

Domain	Start	End	E-Value	Type
Blast:TPR	183	209	9e-11	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000167842
AA Change: S206L

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000127781
Gene: ENSMUSG00000022249
AA Change: S206L

Domain	Start	End	E-Value	Type
low complexity region	18	29	N/A	INTRINSIC
Pfam:TPR_1	102	133	3.3e-6	PFAM
low complexity region	148	160	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167842
AA Change: S206L

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

100% (37/37)

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adhfe1	A	T	1: 9,561,628		probably benign	Het
C330007P06Rik	C	A	X: 36,824,159	C206F	probably benign	Het
Cd209c	T	C	8: 3,954,635		noncoding transcript	Het
Cntnap1	A	G	11: 101,182,253	D561G	probably damaging	Het
Csf1	T	A	3: 107,756,739	T38S	probably damaging	Het
Cyp4b1	T	C	4: 115,636,313	T191A	probably benign	Het
Dapk1	A	T	13: 60,761,589	M1339L	probably benign	Het
Dpm3	T	C	3: 89,266,908	Y59H	probably damaging	Het
Eif2ak4	A	G	2: 118,427,924	Y585C	probably damaging	Het
Ercc1	G	A	7: 19,347,132		probably benign	Het
Fam184b	T	C	5: 45,542,343	D577G	probably benign	Het
Gon4l	C	A	3: 88,907,387	P1888T	probably benign	Het
Hsf2bp	C	T	17: 31,987,348	D270N	probably null	Het
Lactbl1	T	C	4: 136,637,591	V418A	possibly damaging	Het
Lifr	A	T	15: 7,166,898	M188L	probably benign	Het
Ltbp1	G	T	17: 75,312,997	G760V	probably damaging	Het
March11	A	G	15: 26,309,446	E62G	probably damaging	Het
Nlrp12	A	G	7: 3,240,946	L312P	possibly damaging	Het
Olfr365	T	A	2: 37,201,562	M107K	probably benign	Het
Olfr608	T	C	7: 103,470,071	S11P	probably damaging	Het
Olfr898	T	C	9: 38,349,169	F23L	probably benign	Het
Pcdh17	T	C	14: 84,448,271	V726A	possibly damaging	Het
Pdia4	G	A	6: 47,798,392	R495W	probably damaging	Het
Phf20l1	T	C	15: 66,615,222	S369P	probably benign	Het
Polq	G	T	16: 37,013,181	V79F	probably damaging	Het
Prcc	A	G	3: 87,867,407	Y363H	probably damaging	Het
Proser3	A	G	7: 30,540,671	V336A	possibly damaging	Het
Rbbp8	C	T	18: 11,725,410	T646M	probably benign	Het
Rgs1	T	C	1: 144,247,906	T94A	probably benign	Het
Rpl11	G	A	4: 136,051,143		probably benign	Het
Slc14a2	G	A	18: 78,207,068	R62C	probably damaging	Het
Snx9	G	A	17: 5,908,626	W292*	probably null	Het
St14	T	C	9: 31,090,458	I784V	probably benign	Het
Strc	A	G	2: 121,380,823	S14P	unknown	Het
Ubap1	G	A	4: 41,371,850		probably null	Het
Zfr	T	C	15: 12,118,340		probably null	Het

Other mutations in Ttc23l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01143:Ttc23l	APN	15	10530689	missense	probably damaging	1.00
IGL01319:Ttc23l	APN	15	10509406	splice site	probably benign
IGL01562:Ttc23l	APN	15	10551390	splice site	probably benign
IGL01969:Ttc23l	APN	15	10551434	nonsense	probably null
IGL03172:Ttc23l	APN	15	10537566	missense	probably benign	0.06
R0042:Ttc23l	UTSW	15	10551541	missense	probably damaging	1.00
R0042:Ttc23l	UTSW	15	10551541	missense	probably damaging	1.00
R0335:Ttc23l	UTSW	15	10539963	missense	probably benign	0.26
R0554:Ttc23l	UTSW	15	10530657	missense	probably benign	0.12
R0609:Ttc23l	UTSW	15	10504536	missense	probably benign
R0631:Ttc23l	UTSW	15	10539980	missense	probably damaging	1.00
R1703:Ttc23l	UTSW	15	10523658	missense	probably damaging	1.00
R2106:Ttc23l	UTSW	15	10547256	missense	probably damaging	1.00
R2220:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2276:Ttc23l	UTSW	15	10523592	missense	possibly damaging	0.92
R2277:Ttc23l	UTSW	15	10523592	missense	possibly damaging	0.92
R2278:Ttc23l	UTSW	15	10523592	missense	possibly damaging	0.92
R2279:Ttc23l	UTSW	15	10523592	missense	possibly damaging	0.92
R2368:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2368:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2420:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2420:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2421:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2422:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2422:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2830:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2831:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2831:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2979:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2980:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2980:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2981:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2981:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2982:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2982:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2983:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2983:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R3176:Ttc23l	UTSW	15	10547232	missense	possibly damaging	0.83
R3177:Ttc23l	UTSW	15	10547232	missense	possibly damaging	0.83
R3276:Ttc23l	UTSW	15	10547232	missense	possibly damaging	0.83
R3277:Ttc23l	UTSW	15	10547232	missense	possibly damaging	0.83
R3722:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R3722:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R3743:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R3743:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R3767:Ttc23l	UTSW	15	10530695	missense	possibly damaging	0.94
R3921:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R3921:Ttc23l	UTSW	15	10537563	small insertion	probably benign
R3921:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R4091:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R4091:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R4119:Ttc23l	UTSW	15	10539920	missense	probably damaging	1.00
R4120:Ttc23l	UTSW	15	10539920	missense	probably damaging	1.00
R4373:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R4373:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R4375:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R4376:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R4376:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R4377:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R4377:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R5002:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5106:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5107:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5109:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5156:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5157:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5160:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5161:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5259:Ttc23l	UTSW	15	10515150	missense	probably damaging	0.99
R5307:Ttc23l	UTSW	15	10533659	missense	probably damaging	1.00
R5728:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5756:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5772:Ttc23l	UTSW	15	10551469	missense	probably benign	0.01
R5793:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5794:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5847:Ttc23l	UTSW	15	10537596	missense	probably benign	0.07
R6976:Ttc23l	UTSW	15	10537580	nonsense	probably null
R7010:Ttc23l	UTSW	15	10515138	missense	probably damaging	1.00
R7342:Ttc23l	UTSW	15	10551497	missense	probably benign	0.01
R7404:Ttc23l	UTSW	15	10551577	missense	probably damaging	0.98
R7453:Ttc23l	UTSW	15	10533767	missense	probably damaging	1.00
R7584:Ttc23l	UTSW	15	10533708	missense	probably damaging	1.00
R7599:Ttc23l	UTSW	15	10533680	missense	possibly damaging	0.89
R8710:Ttc23l	UTSW	15	10539935	missense	probably damaging	1.00
R8927:Ttc23l	UTSW	15	10530634	missense	probably damaging	1.00
R8928:Ttc23l	UTSW	15	10530634	missense	probably damaging	1.00
R9101:Ttc23l	UTSW	15	10537575	missense	probably benign	0.16
Z1088:Ttc23l	UTSW	15	10533667	missense	probably damaging	1.00
Z1177:Ttc23l	UTSW	15	10533633	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAAACGTGGCAGCGTATATAGTAAG -3'
(R):5'- CTTGTTTTCCCAAGGGTCGC -3'

Sequencing Primer
(F):5'- GCAGCGTATATAGTAAGCTTGC -3'
(R):5'- CCCAAGGGTCGCTTTTGTTAGC -3'

Posted On

2015-07-06