Incidental Mutation 'R4375:Hsf2bp'
ID325084
Institutional Source Beutler Lab
Gene Symbol Hsf2bp
Ensembl Gene ENSMUSG00000002076
Gene Nameheat shock transcription factor 2 binding protein
Synonyms
MMRRC Submission 041119-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4375 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location31944769-32034508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 31987348 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 270 (D270N)
Ref Sequence ENSEMBL: ENSMUSP00000002145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002145]
Predicted Effect probably null
Transcript: ENSMUST00000002145
AA Change: D270N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002145
Gene: ENSMUSG00000002076
AA Change: D270N

DomainStartEndE-ValueType
coiled coil region 50 126 N/A INTRINSIC
low complexity region 214 225 N/A INTRINSIC
SCOP:d1gw5a_ 252 329 3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133308
SMART Domains Protein: ENSMUSP00000115909
Gene: ENSMUSG00000002076

DomainStartEndE-ValueType
transmembrane domain 64 86 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
Meta Mutation Damage Score 0.1324 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HSF2 binding protein (HSF2BP) associates with HSF2. The interaction occurs between the trimerization domain of HSF2 and the amino terminal hydrophilic region of HSF2BP that comprises two leucine zipper motifs. HSF2BP may therefore be involved in modulating HSF2 activation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adhfe1 A T 1: 9,561,628 probably benign Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cntnap1 A G 11: 101,182,253 D561G probably damaging Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Cyp4b1 T C 4: 115,636,313 T191A probably benign Het
Dapk1 A T 13: 60,761,589 M1339L probably benign Het
Dpm3 T C 3: 89,266,908 Y59H probably damaging Het
Eif2ak4 A G 2: 118,427,924 Y585C probably damaging Het
Ercc1 G A 7: 19,347,132 probably benign Het
Fam184b T C 5: 45,542,343 D577G probably benign Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Lactbl1 T C 4: 136,637,591 V418A possibly damaging Het
Lifr A T 15: 7,166,898 M188L probably benign Het
Ltbp1 G T 17: 75,312,997 G760V probably damaging Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Nlrp12 A G 7: 3,240,946 L312P possibly damaging Het
Olfr365 T A 2: 37,201,562 M107K probably benign Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Olfr898 T C 9: 38,349,169 F23L probably benign Het
Pcdh17 T C 14: 84,448,271 V726A possibly damaging Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Phf20l1 T C 15: 66,615,222 S369P probably benign Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Proser3 A G 7: 30,540,671 V336A possibly damaging Het
Rbbp8 C T 18: 11,725,410 T646M probably benign Het
Rgs1 T C 1: 144,247,906 T94A probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Snx9 G A 17: 5,908,626 W292* probably null Het
St14 T C 9: 31,090,458 I784V probably benign Het
Strc A G 2: 121,380,823 S14P unknown Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Ubap1 G A 4: 41,371,850 probably null Het
Zfr T C 15: 12,118,340 probably null Het
Other mutations in Hsf2bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01134:Hsf2bp APN 17 31987404 missense probably damaging 1.00
IGL03274:Hsf2bp APN 17 32007770 missense probably damaging 1.00
R0563:Hsf2bp UTSW 17 32007718 missense probably damaging 1.00
R0632:Hsf2bp UTSW 17 32013346 missense probably damaging 1.00
R0960:Hsf2bp UTSW 17 32007769 missense probably damaging 1.00
R1967:Hsf2bp UTSW 17 31987404 nonsense probably null
R4567:Hsf2bp UTSW 17 31946734 missense probably benign 0.01
R5510:Hsf2bp UTSW 17 31946747 missense unknown
R5546:Hsf2bp UTSW 17 31946695 missense probably damaging 0.98
R5988:Hsf2bp UTSW 17 32011175 critical splice donor site probably null
R7026:Hsf2bp UTSW 17 32033280 missense possibly damaging 0.93
R7459:Hsf2bp UTSW 17 31946734 missense probably benign 0.01
R7790:Hsf2bp UTSW 17 32034479 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCCAGATTTTAACATTGCCAC -3'
(R):5'- TCCTTGAGAGTAGGCAATGAACTC -3'

Sequencing Primer
(F):5'- TGCCACTATGAAAGAGTATTCCTC -3'
(R):5'- CAAGGTGAAATATAATGTGGATAGCC -3'
Posted On2015-07-06