Incidental Mutation 'R4375:Rbbp8'
ID 325086
Institutional Source Beutler Lab
Gene Symbol Rbbp8
Ensembl Gene ENSMUSG00000041238
Gene Name retinoblastoma binding protein 8, endonuclease
Synonyms CtIP, 9930104E21Rik
MMRRC Submission 041119-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4375 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 11766333-11876264 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 11858467 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 646 (T646M)
Ref Sequence ENSEMBL: ENSMUSP00000111527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047322] [ENSMUST00000115861]
AlphaFold Q80YR6
Predicted Effect probably benign
Transcript: ENSMUST00000047322
AA Change: T646M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000046255
Gene: ENSMUSG00000041238
AA Change: T646M

DomainStartEndE-ValueType
Pfam:CtIP_N 20 139 9.6e-61 PFAM
PDB:2L4Z|A 639 675 3e-15 PDB
Pfam:SAE2 790 854 8.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115861
AA Change: T646M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111527
Gene: ENSMUSG00000041238
AA Change: T646M

DomainStartEndE-ValueType
Pfam:CtIP_N 20 139 5.2e-55 PFAM
PDB:2L4Z|A 639 675 3e-15 PDB
Pfam:SAE2 817 854 1.4e-8 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitously expressed nuclear protein. It is found among several proteins that bind directly to retinoblastoma protein, which regulates cell proliferation. This protein complexes with transcriptional co-repressor CTBP. It is also associated with BRCA1 and is thought to modulate the functions of BRCA1 in transcriptional regulation, DNA repair, and/or cell cycle checkpoint control. It is suggested that this gene may itself be a tumor suppressor acting in the same pathway as BRCA1. Three transcript variants encoding two different isoforms have been found for this gene. More transcript variants exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele die at E4.0 as blastocysts fail to enter S phase and arrest at G1, leading to elevated cell death. Heterozygous mutant mice display a shortened lifespan due to formation of multiple tumors, mostly large lymphomasof both B and T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adhfe1 A T 1: 9,631,853 (GRCm39) probably benign Het
Cd209c T C 8: 4,004,635 (GRCm39) noncoding transcript Het
Cntnap1 A G 11: 101,073,079 (GRCm39) D561G probably damaging Het
Csf1 T A 3: 107,664,055 (GRCm39) T38S probably damaging Het
Cyp4b1 T C 4: 115,493,510 (GRCm39) T191A probably benign Het
Dapk1 A T 13: 60,909,403 (GRCm39) M1339L probably benign Het
Dpm3 T C 3: 89,174,215 (GRCm39) Y59H probably damaging Het
Eif2ak4 A G 2: 118,258,405 (GRCm39) Y585C probably damaging Het
Ercc1 G A 7: 19,081,057 (GRCm39) probably benign Het
Fam184b T C 5: 45,699,685 (GRCm39) D577G probably benign Het
Gon4l C A 3: 88,814,694 (GRCm39) P1888T probably benign Het
Hsf2bp C T 17: 32,206,322 (GRCm39) D270N probably null Het
Lactbl1 T C 4: 136,364,902 (GRCm39) V418A possibly damaging Het
Lifr A T 15: 7,196,379 (GRCm39) M188L probably benign Het
Ltbp1 G T 17: 75,619,992 (GRCm39) G760V probably damaging Het
Marchf11 A G 15: 26,309,532 (GRCm39) E62G probably damaging Het
Nlrp12 A G 7: 3,289,576 (GRCm39) L312P possibly damaging Het
Or1l4 T A 2: 37,091,574 (GRCm39) M107K probably benign Het
Or52ae7 T C 7: 103,119,278 (GRCm39) S11P probably damaging Het
Or8c20 T C 9: 38,260,465 (GRCm39) F23L probably benign Het
Pcdh17 T C 14: 84,685,711 (GRCm39) V726A possibly damaging Het
Pdia4 G A 6: 47,775,326 (GRCm39) R495W probably damaging Het
Phf20l1 T C 15: 66,487,071 (GRCm39) S369P probably benign Het
Polq G T 16: 36,833,543 (GRCm39) V79F probably damaging Het
Prcc A G 3: 87,774,714 (GRCm39) Y363H probably damaging Het
Proser3 A G 7: 30,240,096 (GRCm39) V336A possibly damaging Het
Rgs1 T C 1: 144,123,644 (GRCm39) T94A probably benign Het
Rpl11 G A 4: 135,778,454 (GRCm39) probably benign Het
Slc14a2 G A 18: 78,250,283 (GRCm39) R62C probably damaging Het
Snx9 G A 17: 5,958,901 (GRCm39) W292* probably null Het
St14 T C 9: 31,001,754 (GRCm39) I784V probably benign Het
Steep1 C A X: 36,087,812 (GRCm39) C206F probably benign Het
Strc A G 2: 121,211,304 (GRCm39) S14P unknown Het
Ttc23l CT CTTGGATT 15: 10,537,648 (GRCm39) probably benign Het
Ttc23l G A 15: 10,537,652 (GRCm39) S206L probably benign Het
Ubap1 G A 4: 41,371,850 (GRCm39) probably null Het
Zfr T C 15: 12,118,426 (GRCm39) probably null Het
Other mutations in Rbbp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Rbbp8 APN 18 11,855,664 (GRCm39) missense probably benign
IGL01302:Rbbp8 APN 18 11,855,036 (GRCm39) missense probably benign
IGL01965:Rbbp8 APN 18 11,855,317 (GRCm39) missense probably benign 0.04
IGL02076:Rbbp8 APN 18 11,838,876 (GRCm39) missense probably damaging 1.00
IGL02410:Rbbp8 APN 18 11,865,269 (GRCm39) missense probably damaging 1.00
IGL02823:Rbbp8 APN 18 11,865,270 (GRCm39) missense possibly damaging 0.89
IGL02859:Rbbp8 APN 18 11,871,671 (GRCm39) missense probably benign 0.42
IGL02966:Rbbp8 APN 18 11,838,869 (GRCm39) missense possibly damaging 0.88
IGL03022:Rbbp8 APN 18 11,858,559 (GRCm39) splice site probably benign
IGL03274:Rbbp8 APN 18 11,874,133 (GRCm39) splice site probably benign
IGL03367:Rbbp8 APN 18 11,854,776 (GRCm39) missense probably benign 0.08
R0063:Rbbp8 UTSW 18 11,867,614 (GRCm39) splice site probably benign
R0063:Rbbp8 UTSW 18 11,867,614 (GRCm39) splice site probably benign
R0167:Rbbp8 UTSW 18 11,793,979 (GRCm39) nonsense probably null
R0314:Rbbp8 UTSW 18 11,848,875 (GRCm39) missense probably benign 0.17
R0864:Rbbp8 UTSW 18 11,865,241 (GRCm39) splice site probably benign
R1033:Rbbp8 UTSW 18 11,875,762 (GRCm39) missense probably benign 0.41
R1678:Rbbp8 UTSW 18 11,865,372 (GRCm39) missense probably benign 0.05
R1964:Rbbp8 UTSW 18 11,875,736 (GRCm39) missense possibly damaging 0.62
R2002:Rbbp8 UTSW 18 11,860,223 (GRCm39) splice site probably benign
R2015:Rbbp8 UTSW 18 11,853,681 (GRCm39) missense probably benign 0.01
R2240:Rbbp8 UTSW 18 11,810,726 (GRCm39) missense probably damaging 0.99
R2308:Rbbp8 UTSW 18 11,829,833 (GRCm39) missense possibly damaging 0.95
R3946:Rbbp8 UTSW 18 11,851,925 (GRCm39) missense probably benign
R4590:Rbbp8 UTSW 18 11,865,322 (GRCm39) nonsense probably null
R4695:Rbbp8 UTSW 18 11,854,839 (GRCm39) nonsense probably null
R4769:Rbbp8 UTSW 18 11,855,727 (GRCm39) missense probably damaging 1.00
R5161:Rbbp8 UTSW 18 11,855,171 (GRCm39) missense probably damaging 1.00
R5195:Rbbp8 UTSW 18 11,855,208 (GRCm39) missense probably benign 0.00
R5223:Rbbp8 UTSW 18 11,854,747 (GRCm39) missense probably benign 0.19
R5573:Rbbp8 UTSW 18 11,855,664 (GRCm39) missense probably benign
R5671:Rbbp8 UTSW 18 11,875,699 (GRCm39) missense probably benign 0.00
R6051:Rbbp8 UTSW 18 11,871,664 (GRCm39) missense probably benign 0.17
R6995:Rbbp8 UTSW 18 11,851,965 (GRCm39) missense probably damaging 1.00
R7048:Rbbp8 UTSW 18 11,865,277 (GRCm39) missense possibly damaging 0.92
R7261:Rbbp8 UTSW 18 11,838,799 (GRCm39) missense probably damaging 0.99
R7305:Rbbp8 UTSW 18 11,805,638 (GRCm39) critical splice acceptor site probably null
R7319:Rbbp8 UTSW 18 11,865,269 (GRCm39) missense probably damaging 1.00
R7447:Rbbp8 UTSW 18 11,793,934 (GRCm39) missense probably benign 0.00
R7949:Rbbp8 UTSW 18 11,851,892 (GRCm39) missense probably benign 0.00
R8010:Rbbp8 UTSW 18 11,855,290 (GRCm39) missense possibly damaging 0.67
R8116:Rbbp8 UTSW 18 11,855,727 (GRCm39) missense probably damaging 1.00
R8292:Rbbp8 UTSW 18 11,838,769 (GRCm39) missense probably benign
R8300:Rbbp8 UTSW 18 11,838,833 (GRCm39) synonymous silent
R8314:Rbbp8 UTSW 18 11,853,682 (GRCm39) missense probably benign 0.06
R8510:Rbbp8 UTSW 18 11,829,859 (GRCm39) nonsense probably null
R8961:Rbbp8 UTSW 18 11,865,262 (GRCm39) missense probably benign 0.18
R9056:Rbbp8 UTSW 18 11,810,677 (GRCm39) missense possibly damaging 0.65
R9086:Rbbp8 UTSW 18 11,875,736 (GRCm39) missense possibly damaging 0.62
R9375:Rbbp8 UTSW 18 11,838,888 (GRCm39) missense probably benign
R9391:Rbbp8 UTSW 18 11,854,990 (GRCm39) missense possibly damaging 0.49
R9763:Rbbp8 UTSW 18 11,865,261 (GRCm39) missense probably benign 0.01
Z1176:Rbbp8 UTSW 18 11,865,319 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTCTTCAGCTCCGAGGGAT -3'
(R):5'- GCATTGTGCTAGAAGAAAAGGTA -3'

Sequencing Primer
(F):5'- gatgtccttcatcaaacagg -3'
(R):5'- CTATCTTGAGCTGACAGGATGACTC -3'
Posted On 2015-07-06