Incidental Mutation 'R4375:Slc14a2'
ID325087
Institutional Source Beutler Lab
Gene Symbol Slc14a2
Ensembl Gene ENSMUSG00000024552
Gene Namesolute carrier family 14 (urea transporter), member 2
SynonymsUT-A5, UT-A3
MMRRC Submission 041119-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4375 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location78146940-78209094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 78207068 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 62 (R62C)
Ref Sequence ENSEMBL: ENSMUSP00000025434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025434] [ENSMUST00000163367]
Predicted Effect probably damaging
Transcript: ENSMUST00000025434
AA Change: R62C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025434
Gene: ENSMUSG00000024552
AA Change: R62C

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
Pfam:UT 128 423 1.9e-105 PFAM
low complexity region 460 471 N/A INTRINSIC
Pfam:UT 591 886 7.5e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163367
SMART Domains Protein: ENSMUSP00000126416
Gene: ENSMUSG00000024552

DomainStartEndE-ValueType
Pfam:UT 1 292 3.4e-113 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the urea transporter family. In mammalian cells, urea is the chief end product of nitrogen catabolism, and plays an important role in the urinary concentration mechanism. This protein is expressed in the inner medulla of the kidney, and mediates rapid transepithelial urea transport across the inner medullary collecting duct. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mice lacking the collecting duct specific isoforms display decreased urea permeability and urine osmolality and increased urine flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adhfe1 A T 1: 9,561,628 probably benign Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cntnap1 A G 11: 101,182,253 D561G probably damaging Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Cyp4b1 T C 4: 115,636,313 T191A probably benign Het
Dapk1 A T 13: 60,761,589 M1339L probably benign Het
Dpm3 T C 3: 89,266,908 Y59H probably damaging Het
Eif2ak4 A G 2: 118,427,924 Y585C probably damaging Het
Ercc1 G A 7: 19,347,132 probably benign Het
Fam184b T C 5: 45,542,343 D577G probably benign Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Hsf2bp C T 17: 31,987,348 D270N probably null Het
Lactbl1 T C 4: 136,637,591 V418A possibly damaging Het
Lifr A T 15: 7,166,898 M188L probably benign Het
Ltbp1 G T 17: 75,312,997 G760V probably damaging Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Nlrp12 A G 7: 3,240,946 L312P possibly damaging Het
Olfr365 T A 2: 37,201,562 M107K probably benign Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Olfr898 T C 9: 38,349,169 F23L probably benign Het
Pcdh17 T C 14: 84,448,271 V726A possibly damaging Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Phf20l1 T C 15: 66,615,222 S369P probably benign Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Proser3 A G 7: 30,540,671 V336A possibly damaging Het
Rbbp8 C T 18: 11,725,410 T646M probably benign Het
Rgs1 T C 1: 144,247,906 T94A probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Snx9 G A 17: 5,908,626 W292* probably null Het
St14 T C 9: 31,090,458 I784V probably benign Het
Strc A G 2: 121,380,823 S14P unknown Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Ubap1 G A 4: 41,371,850 probably null Het
Zfr T C 15: 12,118,340 probably null Het
Other mutations in Slc14a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Slc14a2 APN 18 78150438 missense possibly damaging 0.65
IGL00763:Slc14a2 APN 18 78192238 missense probably damaging 1.00
IGL01359:Slc14a2 APN 18 78154108 missense probably benign 0.01
IGL01400:Slc14a2 APN 18 78192213 missense probably damaging 1.00
IGL01450:Slc14a2 APN 18 78183530 missense probably damaging 0.97
IGL01469:Slc14a2 APN 18 78155566 missense probably damaging 0.98
IGL02231:Slc14a2 APN 18 78209021 missense possibly damaging 0.92
IGL02340:Slc14a2 APN 18 78163126 missense probably damaging 1.00
IGL02542:Slc14a2 APN 18 78209087 missense probably benign
xi_ning UTSW 18 78195747 missense probably benign 0.01
IGL02991:Slc14a2 UTSW 18 78205834 start codon destroyed probably null 0.77
R0131:Slc14a2 UTSW 18 78192123 missense probably damaging 1.00
R0131:Slc14a2 UTSW 18 78192123 missense probably damaging 1.00
R0132:Slc14a2 UTSW 18 78192123 missense probably damaging 1.00
R0601:Slc14a2 UTSW 18 78157179 nonsense probably null
R1677:Slc14a2 UTSW 18 78163204 missense probably benign
R1749:Slc14a2 UTSW 18 78147080 missense possibly damaging 0.67
R2014:Slc14a2 UTSW 18 78150386 splice site probably benign
R2034:Slc14a2 UTSW 18 78183583 missense probably damaging 0.99
R2264:Slc14a2 UTSW 18 78163089 splice site probably benign
R2278:Slc14a2 UTSW 18 78159944 missense probably benign 0.01
R2920:Slc14a2 UTSW 18 78158297 nonsense probably null
R3878:Slc14a2 UTSW 18 78159074 missense probably benign
R4086:Slc14a2 UTSW 18 78205783 missense probably damaging 1.00
R4237:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4238:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4239:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4300:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4373:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4376:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4440:Slc14a2 UTSW 18 78195747 missense probably benign 0.01
R4551:Slc14a2 UTSW 18 78195853 missense probably benign 0.02
R4636:Slc14a2 UTSW 18 78195792 missense possibly damaging 0.88
R4749:Slc14a2 UTSW 18 78155581 missense probably damaging 1.00
R4921:Slc14a2 UTSW 18 78192188 missense probably damaging 0.97
R4983:Slc14a2 UTSW 18 78150401 missense probably damaging 0.98
R5114:Slc14a2 UTSW 18 78195748 missense possibly damaging 0.62
R5164:Slc14a2 UTSW 18 78157272 missense probably damaging 1.00
R5386:Slc14a2 UTSW 18 78185840 missense possibly damaging 0.65
R5433:Slc14a2 UTSW 18 78208928 missense probably damaging 1.00
R5558:Slc14a2 UTSW 18 78159166 missense possibly damaging 0.94
R5571:Slc14a2 UTSW 18 78209067 missense possibly damaging 0.73
R5693:Slc14a2 UTSW 18 78147014 missense probably benign 0.23
R5715:Slc14a2 UTSW 18 78158336 missense probably damaging 1.00
R5719:Slc14a2 UTSW 18 78209042 missense probably benign 0.06
R6160:Slc14a2 UTSW 18 78158975 critical splice donor site probably null
R6352:Slc14a2 UTSW 18 78209094 start codon destroyed probably null
R6380:Slc14a2 UTSW 18 78146975 missense probably benign 0.00
R6444:Slc14a2 UTSW 18 78154102 missense probably damaging 0.98
R6480:Slc14a2 UTSW 18 78159082 missense possibly damaging 0.80
R6732:Slc14a2 UTSW 18 78192174 missense probably damaging 1.00
R7038:Slc14a2 UTSW 18 78159037 missense probably damaging 0.98
R7553:Slc14a2 UTSW 18 78155588 missense probably damaging 1.00
R7558:Slc14a2 UTSW 18 78192119 missense probably benign 0.07
R7617:Slc14a2 UTSW 18 78159941 missense probably benign
R7693:Slc14a2 UTSW 18 78154003 missense possibly damaging 0.81
R7874:Slc14a2 UTSW 18 78160768 missense probably benign 0.01
R7957:Slc14a2 UTSW 18 78160768 missense probably benign 0.01
Z1088:Slc14a2 UTSW 18 78195780 missense probably damaging 1.00
Z1176:Slc14a2 UTSW 18 78157368 missense probably damaging 1.00
Z1176:Slc14a2 UTSW 18 78157369 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- GACACTCACCTTTCAGCCAG -3'
(R):5'- TGTCCCCAAATGTCCCTATCAAG -3'

Sequencing Primer
(F):5'- AGCCAGTTCTTGCATTCCTTCATG -3'
(R):5'- CAAGTACTTATAATCCCAGCAGATG -3'
Posted On2015-07-06