Incidental Mutation 'R4375:C330007P06Rik'
ID325088
Institutional Source Beutler Lab
Gene Symbol C330007P06Rik
Ensembl Gene ENSMUSG00000006423
Gene NameRIKEN cDNA C330007P06 gene
Synonyms
MMRRC Submission 041119-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.545) question?
Stock #R4375 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location36823737-36874111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 36824159 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 206 (C206F)
Ref Sequence ENSEMBL: ENSMUSP00000110904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115249]
Predicted Effect probably benign
Transcript: ENSMUST00000115249
AA Change: C206F

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000110904
Gene: ENSMUSG00000006423
AA Change: C206F

DomainStartEndE-ValueType
low complexity region 158 177 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] While this gene is well-supported by transcript data, no functional information on its protein products is currently available. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: Male chimeras hemizygous for a gene trapped allele exhibit abnormal midbrain-hindbrain boundary morphology and decreased forebrain size. A subset of male chimeras hemizygous for a different gene trapped allele exhibit embryonic growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adhfe1 A T 1: 9,561,628 probably benign Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cntnap1 A G 11: 101,182,253 D561G probably damaging Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Cyp4b1 T C 4: 115,636,313 T191A probably benign Het
Dapk1 A T 13: 60,761,589 M1339L probably benign Het
Dpm3 T C 3: 89,266,908 Y59H probably damaging Het
Eif2ak4 A G 2: 118,427,924 Y585C probably damaging Het
Ercc1 G A 7: 19,347,132 probably benign Het
Fam184b T C 5: 45,542,343 D577G probably benign Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Hsf2bp C T 17: 31,987,348 D270N probably null Het
Lactbl1 T C 4: 136,637,591 V418A possibly damaging Het
Lifr A T 15: 7,166,898 M188L probably benign Het
Ltbp1 G T 17: 75,312,997 G760V probably damaging Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Nlrp12 A G 7: 3,240,946 L312P possibly damaging Het
Olfr365 T A 2: 37,201,562 M107K probably benign Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Olfr898 T C 9: 38,349,169 F23L probably benign Het
Pcdh17 T C 14: 84,448,271 V726A possibly damaging Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Phf20l1 T C 15: 66,615,222 S369P probably benign Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Proser3 A G 7: 30,540,671 V336A possibly damaging Het
Rbbp8 C T 18: 11,725,410 T646M probably benign Het
Rgs1 T C 1: 144,247,906 T94A probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Snx9 G A 17: 5,908,626 W292* probably null Het
St14 T C 9: 31,090,458 I784V probably benign Het
Strc A G 2: 121,380,823 S14P unknown Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Ubap1 G A 4: 41,371,850 probably null Het
Zfr T C 15: 12,118,340 probably null Het
Other mutations in C330007P06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4376:C330007P06Rik UTSW X 36824159 missense probably benign 0.03
R4377:C330007P06Rik UTSW X 36824159 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CGGCGAACGGTTTCTGATTTC -3'
(R):5'- TGCTAACACTTGGAGGAAGG -3'

Sequencing Primer
(F):5'- CTATTGAGGTTTGAGCCTTTCC -3'
(R):5'- GGACCTTCCCACACACTCACTAG -3'
Posted On2015-07-06