Incidental Mutation 'R4376:Mrps2'
ID325089
Institutional Source Beutler Lab
Gene Symbol Mrps2
Ensembl Gene ENSMUSG00000035772
Gene Namemitochondrial ribosomal protein S2
Synonyms
MMRRC Submission 041120-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.935) question?
Stock #R4376 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location28468066-28471178 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28468859 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 67 (S67P)
Ref Sequence ENSEMBL: ENSMUSP00000036725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038600] [ENSMUST00000086370] [ENSMUST00000127683]
Predicted Effect probably benign
Transcript: ENSMUST00000038600
AA Change: S67P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000036725
Gene: ENSMUSG00000035772
AA Change: S67P

DomainStartEndE-ValueType
Pfam:Ribosomal_S2 81 182 4.6e-23 PFAM
Pfam:Ribosomal_S2 180 257 7.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086370
SMART Domains Protein: ENSMUSP00000083557
Gene: ENSMUSG00000026831

DomainStartEndE-ValueType
Pfam:DUF4490 35 137 1.4e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123533
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126242
Predicted Effect probably benign
Transcript: ENSMUST00000127683
SMART Domains Protein: ENSMUSP00000116111
Gene: ENSMUSG00000026831

DomainStartEndE-ValueType
Pfam:DUF4490 33 122 1.5e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146332
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S2 family. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 A G 10: 14,438,494 S683P probably benign Het
Adgrg6 G A 10: 14,469,050 T53M probably damaging Het
Atp10d T C 5: 72,296,975 L189P probably damaging Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Eaf2 A G 16: 36,800,636 L184P unknown Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam83e A T 7: 45,723,893 S228C probably damaging Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Kit T C 5: 75,640,499 I515T probably benign Het
Kmt2c C T 5: 25,315,326 V1929I probably benign Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Mlh3 C A 12: 85,259,198 R1175L probably benign Het
Nlrp12 A G 7: 3,240,946 L312P possibly damaging Het
Olfr1228 T C 2: 89,249,245 R150G possibly damaging Het
Olfr275 A T 4: 52,826,195 N266I possibly damaging Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pank1 C T 19: 34,877,704 V4I probably benign Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Plce1 T C 19: 38,705,447 probably null Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Rictor T C 15: 6,786,967 V1240A probably benign Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsnaxip1 C A 8: 105,841,801 C372* probably null Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Other mutations in Mrps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01819:Mrps2 APN 2 28468336 missense probably benign 0.00
IGL02250:Mrps2 APN 2 28469545 missense possibly damaging 0.95
IGL03172:Mrps2 APN 2 28469806 missense probably damaging 0.99
R0090:Mrps2 UTSW 2 28468256 missense probably damaging 0.99
R0325:Mrps2 UTSW 2 28469779 missense probably damaging 1.00
R1437:Mrps2 UTSW 2 28468887 missense probably damaging 1.00
R1511:Mrps2 UTSW 2 28469664 missense probably damaging 0.96
R1589:Mrps2 UTSW 2 28469488 missense probably benign 0.06
R1590:Mrps2 UTSW 2 28469488 missense probably benign 0.06
R1591:Mrps2 UTSW 2 28469488 missense probably benign 0.06
R2098:Mrps2 UTSW 2 28468315 missense probably benign 0.04
R4067:Mrps2 UTSW 2 28469770 missense probably benign 0.10
R4541:Mrps2 UTSW 2 28468400 unclassified probably benign
R4761:Mrps2 UTSW 2 28469934 missense probably benign 0.00
R5207:Mrps2 UTSW 2 28469751 missense probably damaging 0.99
R7109:Mrps2 UTSW 2 28468246 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TTGACACTAGTCCCTCGGTG -3'
(R):5'- CCTGTCTGTGAACCAGCATC -3'

Sequencing Primer
(F):5'- TCGGTGTTGCAAAAATGCCC -3'
(R):5'- CAATACTAGCACTGCACTTGGTG -3'
Posted On2015-07-06