Incidental Mutation 'R4376:Olfr1228'
ID325090
Institutional Source Beutler Lab
Gene Symbol Olfr1228
Ensembl Gene ENSMUSG00000099486
Gene Nameolfactory receptor 1228
SynonymsMOR233-1, GA_x6K02T2Q125-50696209-50695274
MMRRC Submission 041120-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R4376 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location89247964-89254062 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89249245 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 150 (R150G)
Ref Sequence ENSEMBL: ENSMUSP00000139920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000190757] [ENSMUST00000215447] [ENSMUST00000216392]
Predicted Effect possibly damaging
Transcript: ENSMUST00000190757
AA Change: R150G

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139920
Gene: ENSMUSG00000099486
AA Change: R150G

DomainStartEndE-ValueType
Pfam:7tm_1 51 298 2.6e-27 PFAM
Pfam:7tm_4 150 292 2.9e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215447
AA Change: R138G

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216392
AA Change: R138G

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 A G 10: 14,438,494 S683P probably benign Het
Adgrg6 G A 10: 14,469,050 T53M probably damaging Het
Atp10d T C 5: 72,296,975 L189P probably damaging Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Eaf2 A G 16: 36,800,636 L184P unknown Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam83e A T 7: 45,723,893 S228C probably damaging Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Kit T C 5: 75,640,499 I515T probably benign Het
Kmt2c C T 5: 25,315,326 V1929I probably benign Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Mlh3 C A 12: 85,259,198 R1175L probably benign Het
Mrps2 T C 2: 28,468,859 S67P probably benign Het
Nlrp12 A G 7: 3,240,946 L312P possibly damaging Het
Olfr275 A T 4: 52,826,195 N266I possibly damaging Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pank1 C T 19: 34,877,704 V4I probably benign Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Plce1 T C 19: 38,705,447 probably null Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Rictor T C 15: 6,786,967 V1240A probably benign Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsnaxip1 C A 8: 105,841,801 C372* probably null Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Other mutations in Olfr1228
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01804:Olfr1228 APN 2 89249222 missense probably benign 0.00
IGL02588:Olfr1228 APN 2 89249698 splice site probably benign
R0384:Olfr1228 UTSW 2 89249070 missense possibly damaging 0.82
R0600:Olfr1228 UTSW 2 89249398 nonsense probably null
R0613:Olfr1228 UTSW 2 89249125 missense probably damaging 1.00
R1564:Olfr1228 UTSW 2 89249672 missense probably benign 0.00
R2115:Olfr1228 UTSW 2 89249530 missense probably damaging 1.00
R2313:Olfr1228 UTSW 2 89248941 missense probably damaging 1.00
R3083:Olfr1228 UTSW 2 89249001 missense probably damaging 0.96
R3790:Olfr1228 UTSW 2 89248993 missense probably benign 0.02
R3948:Olfr1228 UTSW 2 89248992 missense possibly damaging 0.95
R4373:Olfr1228 UTSW 2 89249245 missense possibly damaging 0.90
R4825:Olfr1228 UTSW 2 89248690 utr 3 prime probably null
R5022:Olfr1228 UTSW 2 89249417 missense probably benign 0.00
R5141:Olfr1228 UTSW 2 89249129 nonsense probably null
R5313:Olfr1228 UTSW 2 89249377 missense probably benign 0.05
R6010:Olfr1228 UTSW 2 89248743 missense probably benign 0.00
R7354:Olfr1228 UTSW 2 89248687 utr 3 prime probably null
R7548:Olfr1228 UTSW 2 89249086 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ATGCTGATAGACCCACTGTTAG -3'
(R):5'- CCACTGTCACCCCTAAGATG -3'

Sequencing Primer
(F):5'- TGCTGATAGACCCACTGTTAGAAAAC -3'
(R):5'- CTGTCACCCCTAAGATGATGGTAG -3'
Posted On2015-07-06