Incidental Mutation 'R4376:Pdia4'
ID325099
Institutional Source Beutler Lab
Gene Symbol Pdia4
Ensembl Gene ENSMUSG00000025823
Gene Nameprotein disulfide isomerase associated 4
SynonymsCai, U48620, Erp72, ERp72
MMRRC Submission 041120-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4376 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location47796141-47813430 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 47798392 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 495 (R495W)
Ref Sequence ENSEMBL: ENSMUSP00000076521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077290]
Predicted Effect probably damaging
Transcript: ENSMUST00000077290
AA Change: R495W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076521
Gene: ENSMUSG00000025823
AA Change: R495W

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 29 57 N/A INTRINSIC
Pfam:Thioredoxin 59 163 4.1e-34 PFAM
Pfam:Calsequestrin 165 388 5.2e-13 PFAM
Pfam:Thioredoxin 174 278 3e-34 PFAM
Pfam:Thioredoxin_6 308 500 5.9e-21 PFAM
Pfam:Thioredoxin 522 630 5e-33 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, three catalytically active thioredoxin (TRX) domains, two TRX-like domains and a C-terminal ER-retention sequence. This protein, when bound to cyclophilin B, enhances the rate of immunoglobulin G intermolecular disulfide bonding and antibody assembly. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in platelets exhibit decreased platelet aggregation and increased bleeding time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 G A 10: 14,469,050 T53M probably damaging Het
Adgrg6 A G 10: 14,438,494 S683P probably benign Het
Atp10d T C 5: 72,296,975 L189P probably damaging Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Eaf2 A G 16: 36,800,636 L184P unknown Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam83e A T 7: 45,723,893 S228C probably damaging Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Kit T C 5: 75,640,499 I515T probably benign Het
Kmt2c C T 5: 25,315,326 V1929I probably benign Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Mlh3 C A 12: 85,259,198 R1175L probably benign Het
Mrps2 T C 2: 28,468,859 S67P probably benign Het
Nlrp12 A G 7: 3,240,946 L312P possibly damaging Het
Olfr1228 T C 2: 89,249,245 R150G possibly damaging Het
Olfr275 A T 4: 52,826,195 N266I possibly damaging Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pank1 C T 19: 34,877,704 V4I probably benign Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Plce1 T C 19: 38,705,447 probably null Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Rictor T C 15: 6,786,967 V1240A probably benign Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsnaxip1 C A 8: 105,841,801 C372* probably null Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Other mutations in Pdia4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01882:Pdia4 APN 6 47803478 missense probably benign 0.25
IGL02207:Pdia4 APN 6 47796807 missense probably benign 0.01
IGL02456:Pdia4 APN 6 47803495 missense probably benign 0.19
R0078:Pdia4 UTSW 6 47798410 missense possibly damaging 0.51
R0501:Pdia4 UTSW 6 47801002 missense probably damaging 1.00
R0622:Pdia4 UTSW 6 47806518 missense probably damaging 1.00
R1243:Pdia4 UTSW 6 47807120 missense probably damaging 1.00
R1635:Pdia4 UTSW 6 47799199 missense possibly damaging 0.85
R1830:Pdia4 UTSW 6 47796761 nonsense probably null
R1853:Pdia4 UTSW 6 47813227 missense unknown
R1854:Pdia4 UTSW 6 47813227 missense unknown
R1951:Pdia4 UTSW 6 47803879 missense probably damaging 1.00
R1990:Pdia4 UTSW 6 47796655 missense probably benign
R2126:Pdia4 UTSW 6 47796837 missense probably damaging 1.00
R2163:Pdia4 UTSW 6 47798407 missense possibly damaging 0.77
R2351:Pdia4 UTSW 6 47796914 splice site probably null
R2415:Pdia4 UTSW 6 47806556 missense probably benign 0.27
R4375:Pdia4 UTSW 6 47798392 missense probably damaging 1.00
R4377:Pdia4 UTSW 6 47798392 missense probably damaging 1.00
R5132:Pdia4 UTSW 6 47796735 missense probably benign 0.01
R5250:Pdia4 UTSW 6 47796685 missense possibly damaging 0.55
R5339:Pdia4 UTSW 6 47796685 missense possibly damaging 0.55
R5432:Pdia4 UTSW 6 47798466 missense possibly damaging 0.89
R5541:Pdia4 UTSW 6 47796637 missense probably damaging 1.00
R5769:Pdia4 UTSW 6 47815512 unclassified probably benign
R5873:Pdia4 UTSW 6 47808176 missense probably damaging 1.00
R6340:Pdia4 UTSW 6 47801018 missense probably benign 0.43
R7187:Pdia4 UTSW 6 47813259 missense unknown
R7231:Pdia4 UTSW 6 47800957 missense probably benign
R7791:Pdia4 UTSW 6 47807122 missense probably damaging 1.00
RF033:Pdia4 UTSW 6 47808288 small deletion probably benign
RF042:Pdia4 UTSW 6 47808306 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GAGAGGAGATTAGGTGGCTTCC -3'
(R):5'- TCAGTTTTGGCGTAACAAAGTCC -3'

Sequencing Primer
(F):5'- AGATTAGGTGGCTTCCTCTATCATG -3'
(R):5'- GTTTTGGCGTAACAAAGTCCTAGAG -3'
Posted On2015-07-06