Incidental Mutation 'R0010:Oc90'
ID32510
Institutional Source Beutler Lab
Gene Symbol Oc90
Ensembl Gene ENSMUSG00000015001
Gene Nameotoconin 90
SynonymsPla2ll, PLA2L, Ocn-95
MMRRC Submission 038305-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R0010 (G1)
Quality Score163
Status Validated (trace)
Chromosome15
Chromosomal Location65876053-65912397 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 65876548 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 371 (C371Y)
Ref Sequence ENSEMBL: ENSMUSP00000078709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015146] [ENSMUST00000060522] [ENSMUST00000079776]
Predicted Effect probably benign
Transcript: ENSMUST00000015146
SMART Domains Protein: ENSMUSP00000015146
Gene: ENSMUSG00000015002

DomainStartEndE-ValueType
SCOP:d1gw5a_ 226 584 5e-4 SMART
low complexity region 709 720 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000060522
AA Change: C403Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062865
Gene: ENSMUSG00000015001
AA Change: C403Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PA2c 74 190 1.75e-15 SMART
PA2c 314 429 3.5e-15 SMART
low complexity region 446 458 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079776
AA Change: C371Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078709
Gene: ENSMUSG00000015001
AA Change: C371Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PA2c 74 190 1.75e-15 SMART
PA2c 282 397 3.5e-15 SMART
low complexity region 414 426 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000135442
AA Change: C247Y
SMART Domains Protein: ENSMUSP00000114254
Gene: ENSMUSG00000015001
AA Change: C247Y

DomainStartEndE-ValueType
internal_repeat_1 2 67 2.77e-7 PROSPERO
PA2c 159 274 3.5e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147776
SMART Domains Protein: ENSMUSP00000118937
Gene: ENSMUSG00000015001

DomainStartEndE-ValueType
PA2c 122 220 8.1e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000156996
AA Change: C371Y
SMART Domains Protein: ENSMUSP00000121227
Gene: ENSMUSG00000015001
AA Change: C371Y

DomainStartEndE-ValueType
PA2c 58 174 1.75e-15 SMART
PA2c 283 398 3.5e-15 SMART
low complexity region 415 427 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Meta Mutation Damage Score 0.6163 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (89/89)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit reduced, enlarged, and loose otoliths, and thin cupula, saccule, utricle and tectorial membranes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,205,609 probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Bbs7 T C 3: 36,607,717 probably null Het
BC037034 T C 5: 138,260,293 probably null Het
Cacna1h T C 17: 25,380,844 K1566E probably damaging Het
Ccdc73 C T 2: 104,980,987 probably benign Het
Cd74 A T 18: 60,803,896 probably benign Het
Cd74 A T 18: 60,809,071 H124L probably benign Het
Cdk5rap2 T C 4: 70,243,459 E270G probably benign Het
Ces2a G A 8: 104,741,396 D520N probably benign Het
Cldnd1 T A 16: 58,731,259 probably benign Het
Cox17 T A 16: 38,347,170 C24S possibly damaging Het
Cyp2b9 T A 7: 26,186,753 probably benign Het
Dennd4a T C 9: 64,896,715 L1112P probably benign Het
Dennd4c T C 4: 86,781,577 S222P probably damaging Het
Dhx37 T A 5: 125,431,616 Q85L probably benign Het
Egfem1 G T 3: 29,582,919 C192F probably damaging Het
Eif3f A T 7: 108,941,005 N336Y possibly damaging Het
Evc2 T A 5: 37,417,449 L1016Q probably damaging Het
Fam114a2 G T 11: 57,514,156 T40N probably damaging Het
Fam135b T C 15: 71,622,032 K16R probably damaging Het
Fcho1 A G 8: 71,709,999 Y725H probably damaging Het
Frem1 T C 4: 83,000,098 I536V probably benign Het
Ginm1 T C 10: 7,775,374 probably benign Het
Glrb A T 3: 80,860,315 probably benign Het
Glt6d1 C A 2: 25,794,727 probably null Het
Gm10320 T C 13: 98,489,546 Y110C probably damaging Het
Gm20388 G A 8: 122,270,598 probably benign Het
Gm3985 A T 8: 32,942,456 noncoding transcript Het
Gm5422 A G 10: 31,249,754 noncoding transcript Het
Igkv6-29 A T 6: 70,138,770 probably benign Het
Inpp5d G A 1: 87,697,546 probably null Het
Itpr3 T G 17: 27,120,977 V2610G probably damaging Het
Kmt5c T A 7: 4,746,208 M88K probably benign Het
Lrp12 C T 15: 39,878,276 A367T probably damaging Het
Ltbp1 A G 17: 75,363,391 T1476A probably damaging Het
Mcoln2 C T 3: 146,183,561 T374M probably damaging Het
Milr1 T G 11: 106,767,003 *209G probably null Het
Mitf A G 6: 97,807,281 K33R probably benign Het
Mon2 A C 10: 123,032,694 S485A probably damaging Het
Mpdu1 C T 11: 69,658,841 G47R probably damaging Het
Ms4a4d A G 19: 11,554,826 N112S probably damaging Het
Mybpc3 G A 2: 91,134,833 W1082* probably null Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Naa15 A T 3: 51,436,213 probably null Het
Nav3 A G 10: 109,823,226 probably benign Het
Nek7 T A 1: 138,544,204 Q66L possibly damaging Het
Nktr G A 9: 121,741,166 probably benign Het
Nlgn1 G T 3: 25,435,842 probably benign Het
Npr1 T C 3: 90,454,832 E1002G probably damaging Het
Nup133 A T 8: 123,904,579 I1072N probably damaging Het
Olfr835 A T 9: 19,035,322 L66F probably damaging Het
Olfr901 A T 9: 38,430,920 I213F possibly damaging Het
Olfr994 A T 2: 85,429,895 D311E probably benign Het
Pradc1 A T 6: 85,447,231 N44K probably damaging Het
Pradc1 T C 6: 85,447,620 D116G probably damaging Het
Ptprk G A 10: 28,585,969 C91Y probably damaging Het
Pus7 T C 5: 23,747,845 I491V probably benign Het
Rock1 T A 18: 10,084,380 D951V probably damaging Het
Scgb2b26 T A 7: 33,944,349 E55D probably damaging Het
Scn8a T C 15: 101,013,573 V958A probably damaging Het
Sec14l1 T C 11: 117,143,770 probably benign Het
Sec24c A G 14: 20,689,261 probably benign Het
Sema6b C T 17: 56,124,105 E853K probably benign Het
Sgk1 G A 10: 21,997,438 probably null Het
Shprh C T 10: 11,151,931 T94I probably benign Het
Slc16a3 T C 11: 120,956,705 S240P probably benign Het
Slc5a8 T C 10: 88,886,590 V95A probably benign Het
Smg1 A T 7: 118,171,859 probably benign Het
Spta1 G A 1: 174,217,943 V1556I probably benign Het
Svs1 A T 6: 48,988,906 H616L probably damaging Het
Trappc4 G A 9: 44,405,231 probably benign Het
Tubgcp6 A G 15: 89,103,183 S1188P probably benign Het
Txlna T G 4: 129,629,086 D487A probably benign Het
Ube2d2b T C 5: 107,830,636 F51S possibly damaging Het
Vmn2r6 G A 3: 64,559,545 Q178* probably null Het
Wdfy3 T C 5: 101,848,349 T3234A probably damaging Het
Ylpm1 C A 12: 85,029,026 Q384K probably damaging Het
Zbtb41 T G 1: 139,423,530 V127G probably damaging Het
Zfp605 T A 5: 110,127,534 C173S probably benign Het
Zfp608 A T 18: 54,895,214 probably benign Het
Zhx2 T C 15: 57,821,274 V13A possibly damaging Het
Other mutations in Oc90
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Oc90 APN 15 65889591 missense probably benign 0.00
IGL01746:Oc90 APN 15 65889401 splice site probably benign
IGL02101:Oc90 APN 15 65897789 missense probably damaging 1.00
IGL02175:Oc90 APN 15 65883825 missense possibly damaging 0.96
IGL02691:Oc90 APN 15 65882561 missense probably damaging 1.00
IGL02947:Oc90 APN 15 65888134 missense probably benign 0.16
R0325:Oc90 UTSW 15 65897665 critical splice donor site probably null
R1466:Oc90 UTSW 15 65897720 missense probably damaging 1.00
R1466:Oc90 UTSW 15 65897720 missense probably damaging 1.00
R1496:Oc90 UTSW 15 65876521 missense probably damaging 1.00
R1584:Oc90 UTSW 15 65897720 missense probably damaging 1.00
R1837:Oc90 UTSW 15 65889680 missense probably damaging 1.00
R3552:Oc90 UTSW 15 65878801 missense possibly damaging 0.81
R4018:Oc90 UTSW 15 65887608 missense probably benign 0.00
R4515:Oc90 UTSW 15 65892393 missense probably damaging 0.96
R4700:Oc90 UTSW 15 65881505 missense possibly damaging 0.91
R4828:Oc90 UTSW 15 65881559 missense probably damaging 1.00
R5135:Oc90 UTSW 15 65883830 missense probably benign 0.00
R5320:Oc90 UTSW 15 65882608 missense probably benign 0.06
R5727:Oc90 UTSW 15 65881539 missense possibly damaging 0.61
R5837:Oc90 UTSW 15 65876446 missense probably benign 0.03
R6086:Oc90 UTSW 15 65889711 missense probably damaging 1.00
R6807:Oc90 UTSW 15 65889614 missense probably damaging 1.00
R8499:Oc90 UTSW 15 65881556 missense probably damaging 1.00
Z1177:Oc90 UTSW 15 65876347 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACGTAGCATCTTATTTCCCACC -3'
(R):5'- AGGGCTACTTCCTAGCAGAAGGAAC -3'

Sequencing Primer
(F):5'- TATTTCCCACCGAGGGGTC -3'
(R):5'- CCTAGCAGAAGGAACAGACTAGAC -3'
Posted On2013-05-09