Incidental Mutation 'R4376:Tsnaxip1'
ID325102
Institutional Source Beutler Lab
Gene Symbol Tsnaxip1
Ensembl Gene ENSMUSG00000031893
Gene Nametranslin-associated factor X (Tsnax) interacting protein 1
Synonyms1700016K08Rik, TXI1
MMRRC Submission 041120-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.589) question?
Stock #R4376 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105827731-105844680 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 105841801 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 372 (C372*)
Ref Sequence ENSEMBL: ENSMUSP00000148715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034365] [ENSMUST00000040776] [ENSMUST00000212431] [ENSMUST00000212566]
Predicted Effect probably null
Transcript: ENSMUST00000034365
AA Change: C372*
SMART Domains Protein: ENSMUSP00000034365
Gene: ENSMUSG00000031893
AA Change: C372*

DomainStartEndE-ValueType
Pfam:TSNAXIP1_N 98 209 3.5e-33 PFAM
coiled coil region 304 342 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040776
SMART Domains Protein: ENSMUSP00000038188
Gene: ENSMUSG00000036672

DomainStartEndE-ValueType
Pfam:CENP-T_N 1 374 4.2e-174 PFAM
Pfam:CENP-T_C 404 507 5.4e-36 PFAM
Pfam:CENP-S 424 479 3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211949
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212357
Predicted Effect probably benign
Transcript: ENSMUST00000212431
Predicted Effect probably null
Transcript: ENSMUST00000212566
AA Change: C372*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212803
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 A G 10: 14,438,494 S683P probably benign Het
Adgrg6 G A 10: 14,469,050 T53M probably damaging Het
Atp10d T C 5: 72,296,975 L189P probably damaging Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Eaf2 A G 16: 36,800,636 L184P unknown Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam83e A T 7: 45,723,893 S228C probably damaging Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Kit T C 5: 75,640,499 I515T probably benign Het
Kmt2c C T 5: 25,315,326 V1929I probably benign Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Mlh3 C A 12: 85,259,198 R1175L probably benign Het
Mrps2 T C 2: 28,468,859 S67P probably benign Het
Nlrp12 A G 7: 3,240,946 L312P possibly damaging Het
Olfr1228 T C 2: 89,249,245 R150G possibly damaging Het
Olfr275 A T 4: 52,826,195 N266I possibly damaging Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pank1 C T 19: 34,877,704 V4I probably benign Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Plce1 T C 19: 38,705,447 probably null Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Rictor T C 15: 6,786,967 V1240A probably benign Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Other mutations in Tsnaxip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Tsnaxip1 APN 8 105841423 missense probably benign 0.04
IGL00490:Tsnaxip1 APN 8 105842184 missense probably damaging 1.00
IGL00849:Tsnaxip1 APN 8 105842168 missense probably damaging 0.99
IGL01756:Tsnaxip1 APN 8 105842788 splice site probably benign
IGL01821:Tsnaxip1 APN 8 105837516 missense probably damaging 0.96
IGL02278:Tsnaxip1 APN 8 105827781 utr 5 prime probably benign
IGL02290:Tsnaxip1 APN 8 105833487 missense probably benign 0.00
IGL02980:Tsnaxip1 UTSW 8 105842210 missense probably damaging 0.96
R0239:Tsnaxip1 UTSW 8 105844488 missense possibly damaging 0.96
R0239:Tsnaxip1 UTSW 8 105844488 missense possibly damaging 0.96
R1544:Tsnaxip1 UTSW 8 105827751 start gained probably benign
R1939:Tsnaxip1 UTSW 8 105840038 missense probably benign 0.04
R3024:Tsnaxip1 UTSW 8 105841743 missense probably damaging 1.00
R3695:Tsnaxip1 UTSW 8 105833535 missense possibly damaging 0.61
R3853:Tsnaxip1 UTSW 8 105840701 splice site probably benign
R4044:Tsnaxip1 UTSW 8 105833545 splice site probably null
R4627:Tsnaxip1 UTSW 8 105841407 missense probably damaging 1.00
R4790:Tsnaxip1 UTSW 8 105833523 missense probably benign 0.12
R5806:Tsnaxip1 UTSW 8 105837496 missense possibly damaging 0.83
R5814:Tsnaxip1 UTSW 8 105843971 missense probably benign 0.00
R6045:Tsnaxip1 UTSW 8 105844187 missense probably benign 0.24
R6374:Tsnaxip1 UTSW 8 105841540 missense possibly damaging 0.55
R6406:Tsnaxip1 UTSW 8 105843983 missense probably benign 0.14
R7915:Tsnaxip1 UTSW 8 105842781 missense possibly damaging 0.88
R7918:Tsnaxip1 UTSW 8 105844535 missense probably benign 0.00
R8317:Tsnaxip1 UTSW 8 105827806 missense probably benign 0.07
R8377:Tsnaxip1 UTSW 8 105842547 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTGCCCACAGCTAGAAAG -3'
(R):5'- CCAGAATCTTAGATGGCCTCTG -3'

Sequencing Primer
(F):5'- AGCCTGAAAGCCGACTATG -3'
(R):5'- GGAAGAAGTCTTTCTCCCGAAGC -3'
Posted On2015-07-06