Incidental Mutation 'R4376:Pfn4'
ID325108
Institutional Source Beutler Lab
Gene Symbol Pfn4
Ensembl Gene ENSMUSG00000020639
Gene Nameprofilin family, member 4
Synonyms
MMRRC Submission 041120-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4376 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location4769022-4778813 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4770182 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 10 (D10E)
Ref Sequence ENSEMBL: ENSMUSP00000136765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020967] [ENSMUST00000053458] [ENSMUST00000178879] [ENSMUST00000218199] [ENSMUST00000218575] [ENSMUST00000219438] [ENSMUST00000219503] [ENSMUST00000219898]
Predicted Effect probably damaging
Transcript: ENSMUST00000020967
AA Change: D10E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020967
Gene: ENSMUSG00000020639
AA Change: D10E

DomainStartEndE-ValueType
Pfam:Profilin 4 124 5.4e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053458
Predicted Effect probably damaging
Transcript: ENSMUST00000178879
AA Change: D10E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136765
Gene: ENSMUSG00000020639
AA Change: D10E

DomainStartEndE-ValueType
Pfam:Profilin 5 124 9.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218199
Predicted Effect probably benign
Transcript: ENSMUST00000218575
Predicted Effect probably damaging
Transcript: ENSMUST00000219438
AA Change: D10E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000219503
AA Change: D10E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000219898
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 A G 10: 14,438,494 S683P probably benign Het
Adgrg6 G A 10: 14,469,050 T53M probably damaging Het
Atp10d T C 5: 72,296,975 L189P probably damaging Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Eaf2 A G 16: 36,800,636 L184P unknown Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam83e A T 7: 45,723,893 S228C probably damaging Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Kit T C 5: 75,640,499 I515T probably benign Het
Kmt2c C T 5: 25,315,326 V1929I probably benign Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Mlh3 C A 12: 85,259,198 R1175L probably benign Het
Mrps2 T C 2: 28,468,859 S67P probably benign Het
Nlrp12 A G 7: 3,240,946 L312P possibly damaging Het
Olfr1228 T C 2: 89,249,245 R150G possibly damaging Het
Olfr275 A T 4: 52,826,195 N266I possibly damaging Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pank1 C T 19: 34,877,704 V4I probably benign Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Plce1 T C 19: 38,705,447 probably null Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Rictor T C 15: 6,786,967 V1240A probably benign Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsnaxip1 C A 8: 105,841,801 C372* probably null Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Other mutations in Pfn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Pfn4 APN 12 4775505 missense probably damaging 1.00
IGL01522:Pfn4 APN 12 4770240 missense probably benign 0.01
IGL01726:Pfn4 APN 12 4774446 missense probably benign 0.00
IGL02896:Pfn4 APN 12 4775451 missense probably benign 0.02
R2082:Pfn4 UTSW 12 4775439 splice site probably null
R2201:Pfn4 UTSW 12 4774382 splice site probably null
R4373:Pfn4 UTSW 12 4770182 missense probably damaging 0.99
R4377:Pfn4 UTSW 12 4770182 missense probably damaging 0.99
R4692:Pfn4 UTSW 12 4774486 missense probably damaging 1.00
R6762:Pfn4 UTSW 12 4775487 missense probably damaging 1.00
R7711:Pfn4 UTSW 12 4774414 missense possibly damaging 0.77
R8125:Pfn4 UTSW 12 4775487 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACCCTGGATGATGGACC -3'
(R):5'- CCACAGAAACTATCGTACTTTGTG -3'

Sequencing Primer
(F):5'- GGATGATGGACCACTATTTTCACTCG -3'
(R):5'- CTGACATTGTTGAAACATGTTCGG -3'
Posted On2015-07-06