Incidental Mutation 'R4376:Mlh3'
ID325109
Institutional Source Beutler Lab
Gene Symbol Mlh3
Ensembl Gene ENSMUSG00000021245
Gene NamemutL homolog 3
Synonyms
MMRRC Submission 041120-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4376 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location85234520-85270599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 85259198 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 1175 (R1175L)
Ref Sequence ENSEMBL: ENSMUSP00000129900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019378] [ENSMUST00000166821] [ENSMUST00000220854] [ENSMUST00000223230]
Predicted Effect probably benign
Transcript: ENSMUST00000019378
AA Change: R1175L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000019378
Gene: ENSMUSG00000021245
AA Change: R1175L

DomainStartEndE-ValueType
HATPase_c 17 125 1.04e0 SMART
DNA_mis_repair 211 349 8.78e-22 SMART
low complexity region 582 594 N/A INTRINSIC
low complexity region 658 671 N/A INTRINSIC
low complexity region 863 882 N/A INTRINSIC
low complexity region 1078 1096 N/A INTRINSIC
MutL_C 1153 1334 7.45e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166821
AA Change: R1175L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000129900
Gene: ENSMUSG00000021245
AA Change: R1175L

DomainStartEndE-ValueType
HATPase_c 17 125 1.04e0 SMART
DNA_mis_repair 211 349 8.78e-22 SMART
low complexity region 582 594 N/A INTRINSIC
low complexity region 658 671 N/A INTRINSIC
low complexity region 863 882 N/A INTRINSIC
low complexity region 1078 1096 N/A INTRINSIC
MutL_C 1153 1334 7.45e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220854
AA Change: R1207L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221577
Predicted Effect probably benign
Transcript: ENSMUST00000223230
AA Change: R133L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MutL-homolog (MLH) family of DNA mismatch repair (MMR) genes. MLH genes are implicated in maintaining genomic integrity during DNA replication and after meiotic recombination. The protein encoded by this gene functions as a heterodimer with other family members. Somatic mutations in this gene frequently occur in tumors exhibiting microsatellite instability, and germline mutations have been linked to hereditary nonpolyposis colorectal cancer type 7 (HNPCC7). Several alternatively spliced transcript variants have been identified, but the full-length nature of only two transcript variants has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation are sterile. Both oocytes and spermatocytes exhibit meiotic block and die. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 G A 10: 14,469,050 T53M probably damaging Het
Adgrg6 A G 10: 14,438,494 S683P probably benign Het
Atp10d T C 5: 72,296,975 L189P probably damaging Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Eaf2 A G 16: 36,800,636 L184P unknown Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam83e A T 7: 45,723,893 S228C probably damaging Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Kit T C 5: 75,640,499 I515T probably benign Het
Kmt2c C T 5: 25,315,326 V1929I probably benign Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Mrps2 T C 2: 28,468,859 S67P probably benign Het
Nlrp12 A G 7: 3,240,946 L312P possibly damaging Het
Olfr1228 T C 2: 89,249,245 R150G possibly damaging Het
Olfr275 A T 4: 52,826,195 N266I possibly damaging Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pank1 C T 19: 34,877,704 V4I probably benign Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Plce1 T C 19: 38,705,447 probably null Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Rictor T C 15: 6,786,967 V1240A probably benign Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsnaxip1 C A 8: 105,841,801 C372* probably null Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Other mutations in Mlh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Mlh3 APN 12 85267929 missense probably benign
IGL01462:Mlh3 APN 12 85266736 missense probably benign
IGL01961:Mlh3 APN 12 85266344 missense probably benign 0.00
IGL02596:Mlh3 APN 12 85240958 critical splice donor site probably null
IGL03008:Mlh3 APN 12 85240851 missense probably benign 0.23
IGL03142:Mlh3 APN 12 85250301 critical splice donor site probably null
R0032:Mlh3 UTSW 12 85245749 intron probably benign
R0032:Mlh3 UTSW 12 85245749 intron probably benign
R0078:Mlh3 UTSW 12 85268818 missense probably damaging 0.98
R0129:Mlh3 UTSW 12 85266140 splice site probably benign
R0269:Mlh3 UTSW 12 85268405 missense probably benign 0.00
R0393:Mlh3 UTSW 12 85267587 nonsense probably null
R0403:Mlh3 UTSW 12 85268968 missense possibly damaging 0.93
R0409:Mlh3 UTSW 12 85240854 missense possibly damaging 0.95
R0587:Mlh3 UTSW 12 85266419 missense probably benign 0.00
R0701:Mlh3 UTSW 12 85267903 missense probably benign 0.00
R0718:Mlh3 UTSW 12 85247697 missense possibly damaging 0.86
R0883:Mlh3 UTSW 12 85235714 missense possibly damaging 0.89
R0989:Mlh3 UTSW 12 85269395 missense probably benign 0.22
R0990:Mlh3 UTSW 12 85267765 missense probably benign
R1467:Mlh3 UTSW 12 85237600 nonsense probably null
R1467:Mlh3 UTSW 12 85237600 nonsense probably null
R1562:Mlh3 UTSW 12 85266920 missense probably benign 0.14
R1599:Mlh3 UTSW 12 85268369 missense probably damaging 1.00
R1694:Mlh3 UTSW 12 85267141 missense probably damaging 1.00
R1777:Mlh3 UTSW 12 85268754 missense possibly damaging 0.75
R1822:Mlh3 UTSW 12 85266145 splice site probably benign
R1874:Mlh3 UTSW 12 85237513 critical splice donor site probably null
R1914:Mlh3 UTSW 12 85261668 missense probably benign 0.08
R1915:Mlh3 UTSW 12 85261668 missense probably benign 0.08
R2075:Mlh3 UTSW 12 85269141 nonsense probably null
R2083:Mlh3 UTSW 12 85269041 missense probably benign 0.16
R2267:Mlh3 UTSW 12 85260811 missense possibly damaging 0.55
R2334:Mlh3 UTSW 12 85268077 missense probably benign 0.00
R2882:Mlh3 UTSW 12 85267566 missense probably damaging 1.00
R3623:Mlh3 UTSW 12 85268395 missense probably damaging 1.00
R3624:Mlh3 UTSW 12 85268395 missense probably damaging 1.00
R3963:Mlh3 UTSW 12 85268680 missense possibly damaging 0.94
R5334:Mlh3 UTSW 12 85245761 critical splice donor site probably null
R5526:Mlh3 UTSW 12 85269373 nonsense probably null
R5556:Mlh3 UTSW 12 85268493 nonsense probably null
R5611:Mlh3 UTSW 12 85267445 missense probably benign 0.21
R5911:Mlh3 UTSW 12 85268455 missense probably damaging 1.00
R6050:Mlh3 UTSW 12 85240846 missense possibly damaging 0.89
R6221:Mlh3 UTSW 12 85268418 missense possibly damaging 0.94
R6377:Mlh3 UTSW 12 85268497 missense probably damaging 0.97
R6820:Mlh3 UTSW 12 85247723 missense probably damaging 1.00
R6826:Mlh3 UTSW 12 85245824 missense probably benign 0.38
R6992:Mlh3 UTSW 12 85235720 missense probably damaging 1.00
R7217:Mlh3 UTSW 12 85266707 missense probably benign
R7228:Mlh3 UTSW 12 85235656 missense probably benign 0.07
R7348:Mlh3 UTSW 12 85267441 missense probably damaging 0.99
R7599:Mlh3 UTSW 12 85268199 nonsense probably null
R7722:Mlh3 UTSW 12 85267492 missense probably benign 0.01
R7762:Mlh3 UTSW 12 85268284 missense possibly damaging 0.63
R7786:Mlh3 UTSW 12 85266737 missense probably benign 0.00
R8231:Mlh3 UTSW 12 85260798 critical splice donor site probably null
R8415:Mlh3 UTSW 12 85269080 missense probably benign 0.35
RF014:Mlh3 UTSW 12 85268029 missense probably benign
X0024:Mlh3 UTSW 12 85247669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGGTTCTCACTTTAGGTCG -3'
(R):5'- GGTAATGAGGTTTGTGACAAGC -3'

Sequencing Primer
(F):5'- CAGGTTCTCACTTTAGGTCGGTTTTC -3'
(R):5'- TGACAAGCACCGTCTCCTGTG -3'
Posted On2015-07-06