Incidental Mutation 'R4376:Rictor'
ID325112
Institutional Source Beutler Lab
Gene Symbol Rictor
Ensembl Gene ENSMUSG00000050310
Gene NameRPTOR independent companion of MTOR, complex 2
SynonymsD530039E11Rik, 4921505C17Rik, 6030405M08Rik
MMRRC Submission 041120-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4376 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location6708379-6800401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6786967 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1240 (V1240A)
Ref Sequence ENSEMBL: ENSMUSP00000051809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061656]
Predicted Effect probably benign
Transcript: ENSMUST00000061656
AA Change: V1240A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000051809
Gene: ENSMUSG00000050310
AA Change: V1240A

DomainStartEndE-ValueType
RICTOR_N 57 439 4.02e-185 SMART
RICTOR_M 523 742 5.66e-98 SMART
RasGEF_N_2 743 857 1.26e-54 SMART
RICTOR_V 920 992 1.44e-40 SMART
low complexity region 1019 1043 N/A INTRINSIC
RICTOR_phospho 1084 1189 4.06e-58 SMART
low complexity region 1221 1239 N/A INTRINSIC
low complexity region 1255 1266 N/A INTRINSIC
low complexity region 1273 1287 N/A INTRINSIC
low complexity region 1404 1414 N/A INTRINSIC
low complexity region 1464 1474 N/A INTRINSIC
low complexity region 1616 1628 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICTOR and MTOR (FRAP1; MIM 601231) are components of a protein complex that integrates nutrient- and growth factor-derived signals to regulate cell growth (Sarbassov et al., 2004 [PubMed 15268862]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis associated with abnormal placental morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 A G 10: 14,438,494 S683P probably benign Het
Adgrg6 G A 10: 14,469,050 T53M probably damaging Het
Atp10d T C 5: 72,296,975 L189P probably damaging Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Eaf2 A G 16: 36,800,636 L184P unknown Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam83e A T 7: 45,723,893 S228C probably damaging Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Kit T C 5: 75,640,499 I515T probably benign Het
Kmt2c C T 5: 25,315,326 V1929I probably benign Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Mlh3 C A 12: 85,259,198 R1175L probably benign Het
Mrps2 T C 2: 28,468,859 S67P probably benign Het
Nlrp12 A G 7: 3,240,946 L312P possibly damaging Het
Olfr1228 T C 2: 89,249,245 R150G possibly damaging Het
Olfr275 A T 4: 52,826,195 N266I possibly damaging Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pank1 C T 19: 34,877,704 V4I probably benign Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Plce1 T C 19: 38,705,447 probably null Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsnaxip1 C A 8: 105,841,801 C372* probably null Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Other mutations in Rictor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Rictor APN 15 6786590 missense probably damaging 0.99
IGL00785:Rictor APN 15 6776950 missense probably damaging 1.00
IGL00801:Rictor APN 15 6794534 missense probably damaging 1.00
IGL01072:Rictor APN 15 6789562 missense probably damaging 0.98
IGL01139:Rictor APN 15 6778268 missense probably damaging 1.00
IGL01303:Rictor APN 15 6708638 missense probably benign 0.10
IGL01307:Rictor APN 15 6774604 splice site probably null
IGL01767:Rictor APN 15 6777384 missense probably damaging 1.00
IGL01774:Rictor APN 15 6769777 missense probably damaging 1.00
IGL01800:Rictor APN 15 6774701 missense probably damaging 0.99
IGL02192:Rictor APN 15 6786414 missense probably benign 0.00
IGL02503:Rictor APN 15 6786443 missense probably benign 0.06
IGL02652:Rictor APN 15 6776187 critical splice donor site probably null
IGL02656:Rictor APN 15 6776920 missense probably damaging 0.98
IGL02752:Rictor APN 15 6787371 missense probably benign 0.02
IGL03000:Rictor APN 15 6769240 splice site probably benign
IGL03118:Rictor APN 15 6759518 missense possibly damaging 0.93
IGL03182:Rictor APN 15 6789598 missense probably benign 0.08
Tense UTSW 15 6759496 missense possibly damaging 0.94
Tonus UTSW 15 6769334 critical splice donor site probably null
Torrid UTSW 15 6759572 missense probably damaging 1.00
R0149:Rictor UTSW 15 6784107 missense possibly damaging 0.76
R0288:Rictor UTSW 15 6786540 missense probably benign 0.08
R0304:Rictor UTSW 15 6786371 splice site probably null
R0336:Rictor UTSW 15 6776753 critical splice acceptor site probably null
R0361:Rictor UTSW 15 6784107 missense possibly damaging 0.76
R0423:Rictor UTSW 15 6773900 missense possibly damaging 0.77
R0453:Rictor UTSW 15 6708642 missense probably benign 0.01
R0515:Rictor UTSW 15 6769301 missense probably damaging 1.00
R0630:Rictor UTSW 15 6794492 missense probably damaging 1.00
R0730:Rictor UTSW 15 6773986 splice site probably benign
R0744:Rictor UTSW 15 6764278 critical splice acceptor site probably null
R0836:Rictor UTSW 15 6764278 critical splice acceptor site probably null
R0881:Rictor UTSW 15 6791670 missense probably benign
R1114:Rictor UTSW 15 6794005 nonsense probably null
R1367:Rictor UTSW 15 6790638 splice site probably benign
R1655:Rictor UTSW 15 6772212 missense probably benign 0.00
R1678:Rictor UTSW 15 6756471 missense probably benign 0.07
R1679:Rictor UTSW 15 6768090 missense possibly damaging 0.92
R1754:Rictor UTSW 15 6735368 missense probably damaging 1.00
R1757:Rictor UTSW 15 6773862 missense possibly damaging 0.95
R1762:Rictor UTSW 15 6756573 missense probably benign 0.00
R1914:Rictor UTSW 15 6759572 missense probably damaging 1.00
R1915:Rictor UTSW 15 6759572 missense probably damaging 1.00
R1994:Rictor UTSW 15 6776156 missense probably benign 0.18
R2145:Rictor UTSW 15 6765107 missense probably damaging 1.00
R2182:Rictor UTSW 15 6772204 missense probably damaging 0.96
R2191:Rictor UTSW 15 6759614 missense probably benign 0.04
R2357:Rictor UTSW 15 6783562 missense probably damaging 0.99
R2914:Rictor UTSW 15 6769995 critical splice donor site probably null
R3082:Rictor UTSW 15 6774857 missense probably benign 0.15
R3885:Rictor UTSW 15 6759610 missense probably damaging 1.00
R3900:Rictor UTSW 15 6789473 missense probably benign 0.01
R4611:Rictor UTSW 15 6787144 missense possibly damaging 0.75
R4644:Rictor UTSW 15 6777935 nonsense probably null
R4718:Rictor UTSW 15 6783160 missense possibly damaging 0.81
R4822:Rictor UTSW 15 6791680 missense probably benign 0.01
R4980:Rictor UTSW 15 6781660 missense probably damaging 1.00
R5034:Rictor UTSW 15 6768095 missense probably damaging 0.98
R5179:Rictor UTSW 15 6795940 missense probably damaging 1.00
R5386:Rictor UTSW 15 6789504 missense probably benign 0.37
R5532:Rictor UTSW 15 6789565 missense probably damaging 1.00
R5549:Rictor UTSW 15 6786910 missense probably damaging 1.00
R5715:Rictor UTSW 15 6750716 nonsense probably null
R5733:Rictor UTSW 15 6783104 missense probably benign
R5822:Rictor UTSW 15 6794006 missense probably benign 0.00
R5848:Rictor UTSW 15 6794006 missense probably benign 0.00
R5849:Rictor UTSW 15 6794006 missense probably benign 0.00
R5850:Rictor UTSW 15 6794006 missense probably benign 0.00
R5854:Rictor UTSW 15 6794006 missense probably benign 0.00
R5855:Rictor UTSW 15 6794006 missense probably benign 0.00
R5856:Rictor UTSW 15 6794006 missense probably benign 0.00
R5936:Rictor UTSW 15 6784161 missense probably damaging 0.99
R6155:Rictor UTSW 15 6793977 missense probably benign 0.44
R6394:Rictor UTSW 15 6769309 missense possibly damaging 0.59
R6549:Rictor UTSW 15 6796175 missense probably damaging 1.00
R6611:Rictor UTSW 15 6750659 missense probably damaging 1.00
R6657:Rictor UTSW 15 6759496 missense possibly damaging 0.94
R6705:Rictor UTSW 15 6794012 missense probably benign 0.00
R6819:Rictor UTSW 15 6796036 critical splice donor site probably null
R6985:Rictor UTSW 15 6772154 missense probably benign 0.27
R6989:Rictor UTSW 15 6772154 missense probably benign 0.27
R7016:Rictor UTSW 15 6774880 critical splice donor site probably null
R7030:Rictor UTSW 15 6708453 critical splice donor site probably null
R7066:Rictor UTSW 15 6772154 missense probably benign 0.27
R7067:Rictor UTSW 15 6772154 missense probably benign 0.27
R7216:Rictor UTSW 15 6769301 missense probably damaging 1.00
R7396:Rictor UTSW 15 6786981 missense not run
R7449:Rictor UTSW 15 6772154 missense probably benign 0.27
R7450:Rictor UTSW 15 6772154 missense probably benign 0.27
R7452:Rictor UTSW 15 6772154 missense probably benign 0.27
R7616:Rictor UTSW 15 6772154 missense probably benign 0.27
R7620:Rictor UTSW 15 6772154 missense probably benign 0.27
R7643:Rictor UTSW 15 6769269 nonsense probably null
R7699:Rictor UTSW 15 6772154 missense probably benign 0.27
R7700:Rictor UTSW 15 6772154 missense probably benign 0.27
R7749:Rictor UTSW 15 6772154 missense probably benign 0.27
R7750:Rictor UTSW 15 6772154 missense probably benign 0.27
R7751:Rictor UTSW 15 6772154 missense probably benign 0.27
R7753:Rictor UTSW 15 6772154 missense probably benign 0.27
R7841:Rictor UTSW 15 6772154 missense probably benign 0.27
R7894:Rictor UTSW 15 6772154 missense probably benign 0.27
R7897:Rictor UTSW 15 6772154 missense probably benign 0.27
R7898:Rictor UTSW 15 6772154 missense probably benign 0.27
R7937:Rictor UTSW 15 6772154 missense probably benign 0.27
R7944:Rictor UTSW 15 6772154 missense probably benign 0.27
R8062:Rictor UTSW 15 6772154 missense probably benign 0.27
R8063:Rictor UTSW 15 6772154 missense probably benign 0.27
R8094:Rictor UTSW 15 6772154 missense probably benign 0.27
R8119:Rictor UTSW 15 6772154 missense probably benign 0.27
R8134:Rictor UTSW 15 6772154 missense probably benign 0.27
R8166:Rictor UTSW 15 6769334 critical splice donor site probably null
R8324:Rictor UTSW 15 6745562 missense probably damaging 1.00
R8343:Rictor UTSW 15 6778319 critical splice donor site probably null
X0020:Rictor UTSW 15 6756482 missense probably benign 0.32
X0060:Rictor UTSW 15 6786552 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAAGCACCTTGAAGACGCGG -3'
(R):5'- CTCTTCTAGGAAGGGTGTGAGAAG -3'

Sequencing Primer
(F):5'- GGGCAGCACTCCAAGTATTG -3'
(R):5'- GAAGAACCTGGTGGCACC -3'
Posted On2015-07-06