Incidental Mutation 'R4376:Eaf2'
ID325118
Institutional Source Beutler Lab
Gene Symbol Eaf2
Ensembl Gene ENSMUSG00000022838
Gene NameELL associated factor 2
SynonymsTraits, FESTA-L, FESTA-S, U19, Festa
MMRRC Submission 041120-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.661) question?
Stock #R4376 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location36792884-36875003 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36800636 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 184 (L184P)
Ref Sequence ENSEMBL: ENSMUSP00000023537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023537] [ENSMUST00000075946] [ENSMUST00000114825] [ENSMUST00000114829]
Predicted Effect unknown
Transcript: ENSMUST00000023537
AA Change: L184P
SMART Domains Protein: ENSMUSP00000023537
Gene: ENSMUSG00000022838
AA Change: L184P

DomainStartEndE-ValueType
Pfam:EAF 14 116 1.3e-28 PFAM
Predicted Effect silent
Transcript: ENSMUST00000075946
SMART Domains Protein: ENSMUSP00000075331
Gene: ENSMUSG00000022838

DomainStartEndE-ValueType
low complexity region 44 71 N/A INTRINSIC
low complexity region 117 132 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000114825
SMART Domains Protein: ENSMUSP00000110473
Gene: ENSMUSG00000022838

DomainStartEndE-ValueType
low complexity region 44 71 N/A INTRINSIC
low complexity region 117 132 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000114829
SMART Domains Protein: ENSMUSP00000110477
Gene: ENSMUSG00000022838

DomainStartEndE-ValueType
Pfam:EAF 16 115 8.6e-24 PFAM
low complexity region 174 201 N/A INTRINSIC
low complexity region 247 262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231782
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit premature death, enlarged heart and prostate associate with hypertrophy, and increased incidence of tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 A G 10: 14,438,494 S683P probably benign Het
Adgrg6 G A 10: 14,469,050 T53M probably damaging Het
Atp10d T C 5: 72,296,975 L189P probably damaging Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam83e A T 7: 45,723,893 S228C probably damaging Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Kit T C 5: 75,640,499 I515T probably benign Het
Kmt2c C T 5: 25,315,326 V1929I probably benign Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Mlh3 C A 12: 85,259,198 R1175L probably benign Het
Mrps2 T C 2: 28,468,859 S67P probably benign Het
Nlrp12 A G 7: 3,240,946 L312P possibly damaging Het
Olfr1228 T C 2: 89,249,245 R150G possibly damaging Het
Olfr275 A T 4: 52,826,195 N266I possibly damaging Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pank1 C T 19: 34,877,704 V4I probably benign Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Plce1 T C 19: 38,705,447 probably null Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Rictor T C 15: 6,786,967 V1240A probably benign Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsnaxip1 C A 8: 105,841,801 C372* probably null Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Other mutations in Eaf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00826:Eaf2 APN 16 36800676 missense probably benign 0.28
IGL01394:Eaf2 APN 16 36810566 missense probably damaging 1.00
IGL03065:Eaf2 APN 16 36828122 missense probably benign 0.00
R0012:Eaf2 UTSW 16 36808174 splice site probably benign
R0036:Eaf2 UTSW 16 36800658 missense probably benign 0.01
R1629:Eaf2 UTSW 16 36824701 missense probably damaging 0.99
R1779:Eaf2 UTSW 16 36810470 critical splice donor site probably null
R1816:Eaf2 UTSW 16 36808009 splice site probably benign
R1881:Eaf2 UTSW 16 36800579 splice site probably benign
R7360:Eaf2 UTSW 16 36828152 missense probably benign
R7764:Eaf2 UTSW 16 36824683 missense probably damaging 1.00
R7919:Eaf2 UTSW 16 36810552 missense probably damaging 1.00
Z1177:Eaf2 UTSW 16 36824662 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCATGGAAAAGCTTCGAGG -3'
(R):5'- CCAGATGAGTAGTTGTGATAGTTCATC -3'

Sequencing Primer
(F):5'- GAAAAGCTTCGAGGAGCCCTC -3'
(R):5'- GTAGTTGTGATAGTTCATCAGATTCC -3'
Posted On2015-07-06