Incidental Mutation 'R4376:Slc14a2'
ID325120
Institutional Source Beutler Lab
Gene Symbol Slc14a2
Ensembl Gene ENSMUSG00000024552
Gene Namesolute carrier family 14 (urea transporter), member 2
SynonymsUT-A5, UT-A3
MMRRC Submission 041120-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4376 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location78146940-78209094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 78207068 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 62 (R62C)
Ref Sequence ENSEMBL: ENSMUSP00000025434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025434] [ENSMUST00000163367]
Predicted Effect probably damaging
Transcript: ENSMUST00000025434
AA Change: R62C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025434
Gene: ENSMUSG00000024552
AA Change: R62C

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
Pfam:UT 128 423 1.9e-105 PFAM
low complexity region 460 471 N/A INTRINSIC
Pfam:UT 591 886 7.5e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163367
SMART Domains Protein: ENSMUSP00000126416
Gene: ENSMUSG00000024552

DomainStartEndE-ValueType
Pfam:UT 1 292 3.4e-113 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the urea transporter family. In mammalian cells, urea is the chief end product of nitrogen catabolism, and plays an important role in the urinary concentration mechanism. This protein is expressed in the inner medulla of the kidney, and mediates rapid transepithelial urea transport across the inner medullary collecting duct. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mice lacking the collecting duct specific isoforms display decreased urea permeability and urine osmolality and increased urine flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 A G 10: 14,438,494 S683P probably benign Het
Adgrg6 G A 10: 14,469,050 T53M probably damaging Het
Atp10d T C 5: 72,296,975 L189P probably damaging Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Eaf2 A G 16: 36,800,636 L184P unknown Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam83e A T 7: 45,723,893 S228C probably damaging Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Kit T C 5: 75,640,499 I515T probably benign Het
Kmt2c C T 5: 25,315,326 V1929I probably benign Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Mlh3 C A 12: 85,259,198 R1175L probably benign Het
Mrps2 T C 2: 28,468,859 S67P probably benign Het
Nlrp12 A G 7: 3,240,946 L312P possibly damaging Het
Olfr1228 T C 2: 89,249,245 R150G possibly damaging Het
Olfr275 A T 4: 52,826,195 N266I possibly damaging Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pank1 C T 19: 34,877,704 V4I probably benign Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Plce1 T C 19: 38,705,447 probably null Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Rictor T C 15: 6,786,967 V1240A probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsnaxip1 C A 8: 105,841,801 C372* probably null Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Other mutations in Slc14a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Slc14a2 APN 18 78150438 missense possibly damaging 0.65
IGL00763:Slc14a2 APN 18 78192238 missense probably damaging 1.00
IGL01359:Slc14a2 APN 18 78154108 missense probably benign 0.01
IGL01400:Slc14a2 APN 18 78192213 missense probably damaging 1.00
IGL01450:Slc14a2 APN 18 78183530 missense probably damaging 0.97
IGL01469:Slc14a2 APN 18 78155566 missense probably damaging 0.98
IGL02231:Slc14a2 APN 18 78209021 missense possibly damaging 0.92
IGL02340:Slc14a2 APN 18 78163126 missense probably damaging 1.00
IGL02542:Slc14a2 APN 18 78209087 missense probably benign
xi_ning UTSW 18 78195747 missense probably benign 0.01
IGL02991:Slc14a2 UTSW 18 78205834 start codon destroyed probably null 0.77
R0131:Slc14a2 UTSW 18 78192123 missense probably damaging 1.00
R0131:Slc14a2 UTSW 18 78192123 missense probably damaging 1.00
R0132:Slc14a2 UTSW 18 78192123 missense probably damaging 1.00
R0601:Slc14a2 UTSW 18 78157179 nonsense probably null
R1677:Slc14a2 UTSW 18 78163204 missense probably benign
R1749:Slc14a2 UTSW 18 78147080 missense possibly damaging 0.67
R2014:Slc14a2 UTSW 18 78150386 splice site probably benign
R2034:Slc14a2 UTSW 18 78183583 missense probably damaging 0.99
R2264:Slc14a2 UTSW 18 78163089 splice site probably benign
R2278:Slc14a2 UTSW 18 78159944 missense probably benign 0.01
R2920:Slc14a2 UTSW 18 78158297 nonsense probably null
R3878:Slc14a2 UTSW 18 78159074 missense probably benign
R4086:Slc14a2 UTSW 18 78205783 missense probably damaging 1.00
R4237:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4238:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4239:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4300:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4373:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4375:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4440:Slc14a2 UTSW 18 78195747 missense probably benign 0.01
R4551:Slc14a2 UTSW 18 78195853 missense probably benign 0.02
R4636:Slc14a2 UTSW 18 78195792 missense possibly damaging 0.88
R4749:Slc14a2 UTSW 18 78155581 missense probably damaging 1.00
R4921:Slc14a2 UTSW 18 78192188 missense probably damaging 0.97
R4983:Slc14a2 UTSW 18 78150401 missense probably damaging 0.98
R5114:Slc14a2 UTSW 18 78195748 missense possibly damaging 0.62
R5164:Slc14a2 UTSW 18 78157272 missense probably damaging 1.00
R5386:Slc14a2 UTSW 18 78185840 missense possibly damaging 0.65
R5433:Slc14a2 UTSW 18 78208928 missense probably damaging 1.00
R5558:Slc14a2 UTSW 18 78159166 missense possibly damaging 0.94
R5571:Slc14a2 UTSW 18 78209067 missense possibly damaging 0.73
R5693:Slc14a2 UTSW 18 78147014 missense probably benign 0.23
R5715:Slc14a2 UTSW 18 78158336 missense probably damaging 1.00
R5719:Slc14a2 UTSW 18 78209042 missense probably benign 0.06
R6160:Slc14a2 UTSW 18 78158975 critical splice donor site probably null
R6352:Slc14a2 UTSW 18 78209094 start codon destroyed probably null
R6380:Slc14a2 UTSW 18 78146975 missense probably benign 0.00
R6444:Slc14a2 UTSW 18 78154102 missense probably damaging 0.98
R6480:Slc14a2 UTSW 18 78159082 missense possibly damaging 0.80
R6732:Slc14a2 UTSW 18 78192174 missense probably damaging 1.00
R7038:Slc14a2 UTSW 18 78159037 missense probably damaging 0.98
R7553:Slc14a2 UTSW 18 78155588 missense probably damaging 1.00
R7558:Slc14a2 UTSW 18 78192119 missense probably benign 0.07
R7617:Slc14a2 UTSW 18 78159941 missense probably benign
R7693:Slc14a2 UTSW 18 78154003 missense possibly damaging 0.81
Z1088:Slc14a2 UTSW 18 78195780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACACTCACCTTTCAGCCAG -3'
(R):5'- TGTCCCCAAATGTCCCTATCAAG -3'

Sequencing Primer
(F):5'- AGCCAGTTCTTGCATTCCTTCATG -3'
(R):5'- CAAGTACTTATAATCCCAGCAGATG -3'
Posted On2015-07-06