Incidental Mutation 'R4376:C330007P06Rik'
ID325123
Institutional Source Beutler Lab
Gene Symbol C330007P06Rik
Ensembl Gene ENSMUSG00000006423
Gene NameRIKEN cDNA C330007P06 gene
Synonyms
MMRRC Submission 041120-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.448) question?
Stock #R4376 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location36823737-36874111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 36824159 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 206 (C206F)
Ref Sequence ENSEMBL: ENSMUSP00000110904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115249]
Predicted Effect probably benign
Transcript: ENSMUST00000115249
AA Change: C206F

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000110904
Gene: ENSMUSG00000006423
AA Change: C206F

DomainStartEndE-ValueType
low complexity region 158 177 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] While this gene is well-supported by transcript data, no functional information on its protein products is currently available. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: Male chimeras hemizygous for a gene trapped allele exhibit abnormal midbrain-hindbrain boundary morphology and decreased forebrain size. A subset of male chimeras hemizygous for a different gene trapped allele exhibit embryonic growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 G A 10: 14,469,050 T53M probably damaging Het
Adgrg6 A G 10: 14,438,494 S683P probably benign Het
Atp10d T C 5: 72,296,975 L189P probably damaging Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Eaf2 A G 16: 36,800,636 L184P unknown Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam83e A T 7: 45,723,893 S228C probably damaging Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Kit T C 5: 75,640,499 I515T probably benign Het
Kmt2c C T 5: 25,315,326 V1929I probably benign Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Mlh3 C A 12: 85,259,198 R1175L probably benign Het
Mrps2 T C 2: 28,468,859 S67P probably benign Het
Nlrp12 A G 7: 3,240,946 L312P possibly damaging Het
Olfr1228 T C 2: 89,249,245 R150G possibly damaging Het
Olfr275 A T 4: 52,826,195 N266I possibly damaging Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pank1 C T 19: 34,877,704 V4I probably benign Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Plce1 T C 19: 38,705,447 probably null Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Rictor T C 15: 6,786,967 V1240A probably benign Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsnaxip1 C A 8: 105,841,801 C372* probably null Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Other mutations in C330007P06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4375:C330007P06Rik UTSW X 36824159 missense probably benign 0.03
R4377:C330007P06Rik UTSW X 36824159 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CGGCGAACGGTTTCTGATTTC -3'
(R):5'- TGCTAACACTTGGAGGAAGG -3'

Sequencing Primer
(F):5'- CTATTGAGGTTTGAGCCTTTCC -3'
(R):5'- GGACCTTCCCACACACTCACTAG -3'
Posted On2015-07-06