Mutagenetix > Incidental Mutation

Incidental Mutation 'R4377:Kcp'

325143

Institutional Source

Beutler Lab

Gene Symbol

Kcp

Ensembl Gene

ENSMUSG00000059022

Gene Name

kielin/chordin-like protein

Synonyms

Crim2, KCP, LOC333088

MMRRC Submission

041676-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.176) question?

Stock #

R4377 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

29473162-29507952 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 29493203 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 107 (C107Y)

Ref Sequence

ENSEMBL: ENSMUSP00000124771 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078112] [ENSMUST00000091391] [ENSMUST00000101614] [ENSMUST00000159479]

AlphaFold

Q3U492

Predicted Effect

probably damaging
Transcript: ENSMUST00000078112
AA Change: C836Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077251
Gene: ENSMUSG00000059022
AA Change: C836Y

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SCOP:d1fxkc_	64	91	7e-3	SMART
VWC	136	190	1.41e-13	SMART
VWC	194	250	1.24e-9	SMART
VWC	255	311	4.55e-8	SMART
VWC	314	369	8.88e-11	SMART
VWC	428	484	9.15e-13	SMART
VWC	487	543	7.61e-10	SMART
VWC	546	601	4.05e-5	SMART
VWC	604	660	8.28e-11	SMART
VWC	667	723	6.58e-5	SMART
VWC	726	780	2.14e-4	SMART
VWC	783	839	1.98e-8	SMART
VWC	842	898	1.35e-1	SMART
VWC	901	957	5.77e-10	SMART
VWC	960	1015	1.21e-3	SMART
VWC	1018	1083	2.44e-8	SMART
VWC	1090	1143	1.05e-3	SMART
VWC	1150	1207	2.93e-11	SMART
Pfam:VWD	1214	1254	4.9e-11	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000091391
AA Change: C836Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000088954
Gene: ENSMUSG00000059022
AA Change: C836Y

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SCOP:d1fxkc_	64	91	7e-3	SMART
VWC	136	190	1.41e-13	SMART
VWC	194	250	1.24e-9	SMART
VWC	255	311	4.55e-8	SMART
VWC	314	369	8.88e-11	SMART
VWC	428	484	9.15e-13	SMART
VWC	487	543	7.61e-10	SMART
VWC	546	601	4.05e-5	SMART
VWC	604	660	8.28e-11	SMART
VWC	667	723	6.58e-5	SMART
VWC	726	780	2.14e-4	SMART
VWC	783	839	1.98e-8	SMART
VWC	842	898	1.35e-1	SMART
VWC	901	957	5.77e-10	SMART
VWC	960	1015	1.21e-3	SMART
VWC	1018	1082	6.53e-9	SMART
VWC	1089	1142	1.05e-3	SMART
VWC	1149	1206	2.93e-11	SMART
Pfam:VWD	1213	1253	4.6e-11	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000101614
AA Change: C836Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099135
Gene: ENSMUSG00000059022
AA Change: C836Y

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SCOP:d1fxkc_	64	91	8e-3	SMART
VWC	136	190	1.41e-13	SMART
VWC	194	250	1.24e-9	SMART
VWC	255	311	4.55e-8	SMART
VWC	314	369	8.88e-11	SMART
VWC	428	484	9.15e-13	SMART
VWC	487	543	7.61e-10	SMART
VWC	546	601	4.05e-5	SMART
VWC	604	660	8.28e-11	SMART
VWC	667	723	6.58e-5	SMART
VWC	726	780	2.14e-4	SMART
VWC	783	839	1.98e-8	SMART
VWC	842	898	1.35e-1	SMART
VWC	901	957	5.77e-10	SMART
VWC	960	1015	1.21e-3	SMART
VWC	1018	1083	2.44e-8	SMART
VWC	1090	1143	1.05e-3	SMART
VWC	1150	1207	2.93e-11	SMART
VWD	1201	1362	6.09e-50	SMART
C8	1404	1479	1.55e-34	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000159479
AA Change: C107Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124771
Gene: ENSMUSG00000059022
AA Change: C107Y

Domain	Start	End	E-Value	Type
VWC	1	51	4.56e-1	SMART
VWC	54	110	1.98e-8	SMART
VWC	113	169	1.35e-1	SMART
VWC	172	228	5.77e-10	SMART
VWC	231	286	1.21e-3	SMART
VWC	289	353	6.53e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160181

SMART Domains

Protein: ENSMUSP00000125699
Gene: ENSMUSG00000059022

Domain	Start	End	E-Value	Type
VWC	18	74	1.24e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162959

Meta Mutation Damage Score

0.1461

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

98% (57/58)

MGI Phenotype

PHENOTYPE: Homozygous null mice display increased sensitivity to renal injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	T	A	14: 49,770,436	T527S	probably damaging	Het
Adck5	A	G	15: 76,594,335		probably benign	Het
Arhgap22	A	G	14: 33,369,510	M681V	probably damaging	Het
Atp10d	T	C	5: 72,296,975	L189P	probably damaging	Het
BC034090	A	G	1: 155,232,450	C384R	probably benign	Het
C330007P06Rik	C	A	X: 36,824,159	C206F	probably benign	Het
Ccdc180	T	A	4: 45,941,877	L1380Q	probably damaging	Het
Cd209c	T	C	8: 3,954,635		noncoding transcript	Het
Cenpp	A	G	13: 49,494,431		probably benign	Het
Csf1	T	A	3: 107,756,739	T38S	probably damaging	Het
Csn1s2a	T	C	5: 87,775,821	V12A	probably benign	Het
Dapk1	A	G	13: 60,719,684	D235G	probably benign	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Frmd3	T	A	4: 74,128,298		probably null	Het
Gart	G	A	16: 91,634,094	A360V	probably benign	Het
Gm7251	T	A	13: 49,805,200		noncoding transcript	Het
Gon4l	C	A	3: 88,907,387	P1888T	probably benign	Het
Hk1	C	A	10: 62,315,540	K10N	probably damaging	Het
Itgal	A	G	7: 127,328,281	Y981C	probably benign	Het
Kdm2a	C	T	19: 4,329,054	V138M	probably benign	Het
Kit	T	C	5: 75,640,499	I515T	probably benign	Het
Kmt2c	C	T	5: 25,315,326	V1929I	probably benign	Het
Krt33a	T	C	11: 100,012,427	E263G	possibly damaging	Het
Mark2	T	C	19: 7,290,689	I50V	possibly damaging	Het
Mug2	G	T	6: 122,071,007		probably null	Het
Mvk	A	G	5: 114,452,961		probably benign	Het
Myh6	T	A	14: 54,962,108	I249F	probably damaging	Het
Naa15	T	C	3: 51,448,365	I229T	possibly damaging	Het
Napb	A	C	2: 148,732,264		probably null	Het
Ncoa3	T	G	2: 166,054,497	L440R	possibly damaging	Het
Olfr608	T	C	7: 103,470,071	S11P	probably damaging	Het
Olfr965	T	A	9: 39,719,807	F193L	probably benign	Het
Osbpl8	T	A	10: 111,269,419	I245N	possibly damaging	Het
Pdia4	G	A	6: 47,798,392	R495W	probably damaging	Het
Pfn4	T	A	12: 4,770,182	D10E	probably damaging	Het
Plekha5	T	C	6: 140,579,465	Y376H	probably damaging	Het
Pole	T	A	5: 110,337,205	I395K	possibly damaging	Het
Prcc	A	G	3: 87,867,407	Y363H	probably damaging	Het
Ptprc	A	T	1: 138,067,925	M982K	probably benign	Het
Ptpro	T	A	6: 137,380,266	F252I	probably benign	Het
Pusl1	A	G	4: 155,890,580	V188A	probably benign	Het
Rad54l2	A	G	9: 106,693,222	S1300P	probably benign	Het
Rpl11	G	A	4: 136,051,143		probably benign	Het
Rtel1	T	A	2: 181,355,796	H1104Q	probably damaging	Het
Setbp1	T	C	18: 78,859,922	R177G	probably damaging	Het
Skint6	T	C	4: 113,236,518	T143A	possibly damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Zfp583	A	G	7: 6,317,681	S111P	possibly damaging	Het
Zmiz1	T	C	14: 25,636,010	S140P	probably damaging	Het

Other mutations in Kcp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00474:Kcp	APN	6	29482657	missense	probably benign
IGL01344:Kcp	APN	6	29498951	splice site	probably null
IGL01404:Kcp	APN	6	29496639	missense	probably damaging	0.99
IGL01735:Kcp	APN	6	29498879	missense	probably damaging	1.00
IGL01776:Kcp	APN	6	29497908	missense	probably damaging	1.00
IGL02092:Kcp	APN	6	29489032	critical splice donor site	probably null
IGL02252:Kcp	APN	6	29504549	missense	probably damaging	1.00
IGL02690:Kcp	APN	6	29484999	unclassified	probably benign
IGL02817:Kcp	APN	6	29496969	missense	probably damaging	0.97
IGL03074:Kcp	APN	6	29496631	missense	probably damaging	1.00
P0045:Kcp	UTSW	6	29498348	missense	probably damaging	1.00
R0219:Kcp	UTSW	6	29495785	missense	probably damaging	1.00
R0355:Kcp	UTSW	6	29496927	missense	possibly damaging	0.89
R0738:Kcp	UTSW	6	29490439	missense	probably benign	0.24
R1111:Kcp	UTSW	6	29485423	missense	probably benign
R1304:Kcp	UTSW	6	29501292	unclassified	probably benign
R1663:Kcp	UTSW	6	29498965	missense	possibly damaging	0.68
R1808:Kcp	UTSW	6	29505655	missense	probably benign	0.05
R1907:Kcp	UTSW	6	29497835	unclassified	probably benign
R2030:Kcp	UTSW	6	29489072	missense	probably damaging	1.00
R2099:Kcp	UTSW	6	29496165	nonsense	probably null
R3411:Kcp	UTSW	6	29482846	missense	possibly damaging	0.68
R3982:Kcp	UTSW	6	29484637	missense	probably damaging	1.00
R3983:Kcp	UTSW	6	29484637	missense	probably damaging	1.00
R4223:Kcp	UTSW	6	29482258	missense	possibly damaging	0.55
R4570:Kcp	UTSW	6	29491848	nonsense	probably null
R4624:Kcp	UTSW	6	29482814	missense	possibly damaging	0.94
R4694:Kcp	UTSW	6	29493197	missense	probably benign	0.29
R4750:Kcp	UTSW	6	29484626	missense	probably benign	0.03
R4968:Kcp	UTSW	6	29497629	nonsense	probably null
R5053:Kcp	UTSW	6	29496958	missense	probably benign	0.01
R5067:Kcp	UTSW	6	29492108	missense	probably benign	0.06
R5253:Kcp	UTSW	6	29498520	unclassified	probably benign
R5418:Kcp	UTSW	6	29504284	nonsense	probably null
R6020:Kcp	UTSW	6	29502864	missense	probably benign	0.03
R6033:Kcp	UTSW	6	29493194	missense	probably damaging	1.00
R6033:Kcp	UTSW	6	29493194	missense	probably damaging	1.00
R6088:Kcp	UTSW	6	29502632	missense	probably benign
R6178:Kcp	UTSW	6	29482888	missense	possibly damaging	0.68
R6285:Kcp	UTSW	6	29502365	missense	probably benign	0.21
R6310:Kcp	UTSW	6	29493258	missense	probably damaging	0.98
R6369:Kcp	UTSW	6	29484694	missense	probably damaging	1.00
R6860:Kcp	UTSW	6	29505720	missense	probably benign	0.19
R6949:Kcp	UTSW	6	29484612	splice site	probably null
R6962:Kcp	UTSW	6	29482840	missense	probably benign	0.08
R7006:Kcp	UTSW	6	29499170	missense	probably damaging	1.00
R7138:Kcp	UTSW	6	29491862	nonsense	probably null
R7141:Kcp	UTSW	6	29487512	nonsense	probably null
R7153:Kcp	UTSW	6	29499015	missense	probably damaging	1.00
R7162:Kcp	UTSW	6	29497200	splice site	probably null
R7334:Kcp	UTSW	6	29485512	missense	probably damaging	1.00
R7565:Kcp	UTSW	6	29499187	missense	probably damaging	1.00
R7671:Kcp	UTSW	6	29496517	missense	probably benign	0.02
R7766:Kcp	UTSW	6	29496847	missense	probably damaging	0.98
R7781:Kcp	UTSW	6	29497765	missense	probably damaging	1.00
R8702:Kcp	UTSW	6	29482751	missense	probably damaging	1.00
R9384:Kcp	UTSW	6	29496619	critical splice donor site	probably null
R9425:Kcp	UTSW	6	29489152	missense	probably benign
R9553:Kcp	UTSW	6	29485101	missense	probably null	1.00
R9752:Kcp	UTSW	6	29497755	missense	probably damaging	1.00
R9755:Kcp	UTSW	6	29492461	missense	probably damaging	1.00
Z1176:Kcp	UTSW	6	29485012	missense	probably benign	0.23
Z1177:Kcp	UTSW	6	29485525	missense	probably benign	0.45

Predicted Primers

PCR Primer
(F):5'- AGCCACTGGACGGTTTTCAG -3'
(R):5'- TTGGCTCCTCCACTGATAGG -3'

Sequencing Primer
(F):5'- CAGAGCAGGCATATGAGAATTCTG -3'
(R):5'- TCCACTGATAGGCTGTGATTATC -3'

Posted On

2015-07-06