Incidental Mutation 'R4377:Mug2'
ID 325145
Institutional Source Beutler Lab
Gene Symbol Mug2
Ensembl Gene ENSMUSG00000030131
Gene Name murinoglobulin 2
Synonyms
MMRRC Submission 041676-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R4377 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 121983720-122062924 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 122047966 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081777]
AlphaFold P28666
Predicted Effect probably null
Transcript: ENSMUST00000081777
SMART Domains Protein: ENSMUSP00000080469
Gene: ENSMUSG00000030131

DomainStartEndE-ValueType
Pfam:A2M_N 128 221 3.5e-21 PFAM
A2M_N_2 449 599 1.05e-42 SMART
low complexity region 711 728 N/A INTRINSIC
A2M 740 830 7.16e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
low complexity region 994 1005 N/A INTRINSIC
Pfam:A2M_comp 1012 1097 5.8e-34 PFAM
Pfam:A2M_comp 1093 1243 3e-47 PFAM
A2M_recep 1353 1440 1.85e-38 SMART
Meta Mutation Damage Score 0.9486 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck5 A G 15: 76,478,535 (GRCm39) probably benign Het
Arhgap22 A G 14: 33,091,467 (GRCm39) M681V probably damaging Het
Armh4 T A 14: 50,007,893 (GRCm39) T527S probably damaging Het
Atp10d T C 5: 72,454,318 (GRCm39) L189P probably damaging Het
BC034090 A G 1: 155,108,196 (GRCm39) C384R probably benign Het
Ccdc180 T A 4: 45,941,877 (GRCm39) L1380Q probably damaging Het
Cd209c T C 8: 4,004,635 (GRCm39) noncoding transcript Het
Cenpp A G 13: 49,647,907 (GRCm39) probably benign Het
Csf1 T A 3: 107,664,055 (GRCm39) T38S probably damaging Het
Csn1s2a T C 5: 87,923,680 (GRCm39) V12A probably benign Het
Dapk1 A G 13: 60,867,498 (GRCm39) D235G probably benign Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Frmd3 T A 4: 74,046,535 (GRCm39) probably null Het
Gart G A 16: 91,430,982 (GRCm39) A360V probably benign Het
Gm7251 T A 13: 49,958,676 (GRCm39) noncoding transcript Het
Gon4l C A 3: 88,814,694 (GRCm39) P1888T probably benign Het
Hk1 C A 10: 62,151,319 (GRCm39) K10N probably damaging Het
Itgal A G 7: 126,927,453 (GRCm39) Y981C probably benign Het
Kcp C T 6: 29,493,202 (GRCm39) C107Y probably damaging Het
Kdm2a C T 19: 4,379,082 (GRCm39) V138M probably benign Het
Kit T C 5: 75,801,159 (GRCm39) I515T probably benign Het
Kmt2c C T 5: 25,520,324 (GRCm39) V1929I probably benign Het
Krt33a T C 11: 99,903,253 (GRCm39) E263G possibly damaging Het
Mark2 T C 19: 7,268,054 (GRCm39) I50V possibly damaging Het
Mvk A G 5: 114,591,022 (GRCm39) probably benign Het
Myh6 T A 14: 55,199,565 (GRCm39) I249F probably damaging Het
Naa15 T C 3: 51,355,786 (GRCm39) I229T possibly damaging Het
Napb A C 2: 148,574,184 (GRCm39) probably null Het
Ncoa3 T G 2: 165,896,417 (GRCm39) L440R possibly damaging Het
Or52ae7 T C 7: 103,119,278 (GRCm39) S11P probably damaging Het
Or8g52 T A 9: 39,631,103 (GRCm39) F193L probably benign Het
Osbpl8 T A 10: 111,105,280 (GRCm39) I245N possibly damaging Het
Pdia4 G A 6: 47,775,326 (GRCm39) R495W probably damaging Het
Pfn4 T A 12: 4,820,182 (GRCm39) D10E probably damaging Het
Plekha5 T C 6: 140,525,191 (GRCm39) Y376H probably damaging Het
Pole T A 5: 110,485,071 (GRCm39) I395K possibly damaging Het
Prcc A G 3: 87,774,714 (GRCm39) Y363H probably damaging Het
Ptprc A T 1: 137,995,663 (GRCm39) M982K probably benign Het
Ptpro T A 6: 137,357,264 (GRCm39) F252I probably benign Het
Pusl1 A G 4: 155,975,037 (GRCm39) V188A probably benign Het
Rad54l2 A G 9: 106,570,421 (GRCm39) S1300P probably benign Het
Rpl11 G A 4: 135,778,454 (GRCm39) probably benign Het
Rtel1 T A 2: 180,997,589 (GRCm39) H1104Q probably damaging Het
Setbp1 T C 18: 78,903,137 (GRCm39) R177G probably damaging Het
Skint6 T C 4: 113,093,715 (GRCm39) T143A possibly damaging Het
Steep1 C A X: 36,087,812 (GRCm39) C206F probably benign Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,648 (GRCm39) probably benign Het
Ttc23l G A 15: 10,537,652 (GRCm39) S206L probably benign Het
Zfp583 A G 7: 6,320,680 (GRCm39) S111P possibly damaging Het
Zmiz1 T C 14: 25,636,434 (GRCm39) S140P probably damaging Het
Other mutations in Mug2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mug2 APN 6 122,024,446 (GRCm39) missense possibly damaging 0.83
IGL00957:Mug2 APN 6 122,017,613 (GRCm39) missense probably damaging 0.99
IGL01314:Mug2 APN 6 122,058,238 (GRCm39) missense possibly damaging 0.62
IGL01338:Mug2 APN 6 122,026,587 (GRCm39) splice site probably benign
IGL01477:Mug2 APN 6 122,058,643 (GRCm39) splice site probably benign
IGL01926:Mug2 APN 6 122,013,063 (GRCm39) splice site probably benign
IGL02019:Mug2 APN 6 122,024,394 (GRCm39) missense probably benign 0.02
IGL02305:Mug2 APN 6 122,013,015 (GRCm39) missense probably benign
IGL02310:Mug2 APN 6 122,036,082 (GRCm39) splice site probably benign
IGL02484:Mug2 APN 6 122,049,712 (GRCm39) missense probably damaging 1.00
IGL02516:Mug2 APN 6 122,047,802 (GRCm39) missense probably damaging 1.00
IGL02531:Mug2 APN 6 122,049,730 (GRCm39) missense probably damaging 1.00
IGL02666:Mug2 APN 6 122,058,285 (GRCm39) missense probably damaging 1.00
IGL02936:Mug2 APN 6 122,058,346 (GRCm39) critical splice donor site probably null
R0114:Mug2 UTSW 6 122,017,607 (GRCm39) missense probably damaging 1.00
R0119:Mug2 UTSW 6 122,013,022 (GRCm39) missense probably benign 0.00
R0123:Mug2 UTSW 6 122,051,673 (GRCm39) missense possibly damaging 0.89
R0144:Mug2 UTSW 6 122,047,970 (GRCm39) splice site probably benign
R0225:Mug2 UTSW 6 122,051,673 (GRCm39) missense possibly damaging 0.89
R0514:Mug2 UTSW 6 122,058,558 (GRCm39) missense probably damaging 1.00
R0763:Mug2 UTSW 6 122,052,253 (GRCm39) missense probably benign
R0959:Mug2 UTSW 6 122,062,454 (GRCm39) missense probably benign 0.33
R1104:Mug2 UTSW 6 122,036,014 (GRCm39) missense probably benign
R1239:Mug2 UTSW 6 122,058,637 (GRCm39) splice site probably benign
R1318:Mug2 UTSW 6 122,054,361 (GRCm39) missense probably damaging 1.00
R1460:Mug2 UTSW 6 122,017,492 (GRCm39) splice site probably benign
R1706:Mug2 UTSW 6 122,013,191 (GRCm39) splice site probably benign
R1761:Mug2 UTSW 6 122,051,664 (GRCm39) missense probably benign 0.20
R1901:Mug2 UTSW 6 122,048,801 (GRCm39) missense probably benign 0.02
R1913:Mug2 UTSW 6 122,047,829 (GRCm39) missense probably damaging 1.00
R1943:Mug2 UTSW 6 122,056,598 (GRCm39) missense probably benign
R2054:Mug2 UTSW 6 122,054,451 (GRCm39) missense probably damaging 1.00
R2060:Mug2 UTSW 6 122,056,571 (GRCm39) missense probably benign
R2420:Mug2 UTSW 6 122,060,419 (GRCm39) missense probably damaging 1.00
R2432:Mug2 UTSW 6 122,061,335 (GRCm39) missense possibly damaging 0.93
R2916:Mug2 UTSW 6 122,051,683 (GRCm39) splice site probably null
R2918:Mug2 UTSW 6 122,051,683 (GRCm39) splice site probably null
R3423:Mug2 UTSW 6 122,024,465 (GRCm39) splice site probably benign
R3834:Mug2 UTSW 6 122,026,746 (GRCm39) critical splice donor site probably null
R3902:Mug2 UTSW 6 122,052,526 (GRCm39) missense probably damaging 1.00
R3941:Mug2 UTSW 6 122,040,522 (GRCm39) missense probably benign
R4227:Mug2 UTSW 6 122,017,691 (GRCm39) missense probably benign 0.10
R4284:Mug2 UTSW 6 122,040,632 (GRCm39) missense probably benign 0.00
R4287:Mug2 UTSW 6 122,040,632 (GRCm39) missense probably benign 0.00
R4419:Mug2 UTSW 6 122,056,589 (GRCm39) missense probably damaging 1.00
R4498:Mug2 UTSW 6 122,059,711 (GRCm39) missense probably damaging 0.99
R4566:Mug2 UTSW 6 122,056,597 (GRCm39) missense probably benign 0.00
R4690:Mug2 UTSW 6 122,013,255 (GRCm39) missense probably benign
R4732:Mug2 UTSW 6 122,048,831 (GRCm39) missense probably damaging 0.99
R4733:Mug2 UTSW 6 122,048,831 (GRCm39) missense probably damaging 0.99
R4741:Mug2 UTSW 6 122,056,572 (GRCm39) missense probably benign
R4888:Mug2 UTSW 6 122,058,154 (GRCm39) missense probably damaging 1.00
R5199:Mug2 UTSW 6 122,017,619 (GRCm39) missense probably benign
R5347:Mug2 UTSW 6 122,058,551 (GRCm39) missense probably damaging 1.00
R5457:Mug2 UTSW 6 122,026,688 (GRCm39) nonsense probably null
R5495:Mug2 UTSW 6 122,056,609 (GRCm39) missense probably damaging 0.96
R5509:Mug2 UTSW 6 122,061,340 (GRCm39) missense possibly damaging 0.84
R6006:Mug2 UTSW 6 122,060,459 (GRCm39) missense probably null 0.98
R6180:Mug2 UTSW 6 122,056,565 (GRCm39) missense probably benign 0.01
R6184:Mug2 UTSW 6 122,014,005 (GRCm39) missense probably benign
R6199:Mug2 UTSW 6 122,024,398 (GRCm39) missense probably benign 0.05
R6262:Mug2 UTSW 6 122,052,214 (GRCm39) missense probably damaging 1.00
R6416:Mug2 UTSW 6 122,059,713 (GRCm39) missense probably damaging 1.00
R6548:Mug2 UTSW 6 122,024,401 (GRCm39) missense probably damaging 1.00
R6703:Mug2 UTSW 6 122,055,653 (GRCm39) missense probably benign 0.25
R7106:Mug2 UTSW 6 122,059,680 (GRCm39) missense probably damaging 1.00
R7131:Mug2 UTSW 6 122,052,206 (GRCm39) missense probably damaging 1.00
R7372:Mug2 UTSW 6 122,060,425 (GRCm39) missense possibly damaging 0.88
R7379:Mug2 UTSW 6 122,024,446 (GRCm39) missense possibly damaging 0.83
R7419:Mug2 UTSW 6 122,017,529 (GRCm39) missense possibly damaging 0.86
R7423:Mug2 UTSW 6 122,056,685 (GRCm39) missense probably benign 0.00
R7581:Mug2 UTSW 6 122,040,670 (GRCm39) missense probably damaging 1.00
R7582:Mug2 UTSW 6 122,056,603 (GRCm39) missense probably damaging 0.99
R7672:Mug2 UTSW 6 122,017,678 (GRCm39) missense probably benign 0.37
R7713:Mug2 UTSW 6 122,055,754 (GRCm39) missense possibly damaging 0.83
R7759:Mug2 UTSW 6 122,058,317 (GRCm39) missense probably damaging 1.00
R7834:Mug2 UTSW 6 122,013,241 (GRCm39) missense probably benign
R7850:Mug2 UTSW 6 122,052,170 (GRCm39) missense probably damaging 1.00
R8029:Mug2 UTSW 6 122,058,504 (GRCm39) critical splice acceptor site probably null
R8127:Mug2 UTSW 6 122,052,567 (GRCm39) missense probably benign 0.01
R8335:Mug2 UTSW 6 122,017,543 (GRCm39) missense probably benign
R8348:Mug2 UTSW 6 122,049,192 (GRCm39) nonsense probably null
R8557:Mug2 UTSW 6 122,040,660 (GRCm39) missense probably damaging 0.99
R8798:Mug2 UTSW 6 122,058,569 (GRCm39) missense probably damaging 1.00
R8823:Mug2 UTSW 6 122,040,648 (GRCm39) missense possibly damaging 0.89
R9029:Mug2 UTSW 6 122,061,328 (GRCm39) missense probably damaging 1.00
R9153:Mug2 UTSW 6 122,017,627 (GRCm39) missense possibly damaging 0.71
R9185:Mug2 UTSW 6 122,054,442 (GRCm39) missense probably benign 0.06
R9186:Mug2 UTSW 6 122,052,248 (GRCm39) missense probably damaging 0.99
R9418:Mug2 UTSW 6 122,017,700 (GRCm39) missense probably benign 0.00
R9464:Mug2 UTSW 6 122,028,690 (GRCm39) missense probably benign 0.01
R9622:Mug2 UTSW 6 122,028,751 (GRCm39) missense probably benign 0.29
Z1177:Mug2 UTSW 6 122,014,080 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCCTGACACCATCACTG -3'
(R):5'- GTCATGTTCATACTCTTGAGCAAC -3'

Sequencing Primer
(F):5'- CCATCACTGAATGGAAGGCCG -3'
(R):5'- CTCTTTGCTGTGTATATATAGCTAGC -3'
Posted On 2015-07-06