Mutagenetix > Incidental Mutation

Incidental Mutation 'R4377:Itgal'

325150

Institutional Source

Beutler Lab

Gene Symbol

Itgal

Ensembl Gene

ENSMUSG00000030830

Gene Name

integrin alpha L

Synonyms

LFA-1, Ly-21, Cd11a, Ly-15

MMRRC Submission

041676-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.184) question?

Stock #

R4377 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

127296260-127335138 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 127328281 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 981 (Y981C)

Ref Sequence

ENSEMBL: ENSMUSP00000113396 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106306] [ENSMUST00000117762] [ENSMUST00000118405] [ENSMUST00000120857] [ENSMUST00000170971]

AlphaFold

P24063

Predicted Effect

probably benign
Transcript: ENSMUST00000106306
AA Change: Y982C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000101913
Gene: ENSMUSG00000030830
AA Change: Y982C

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Int_alpha	38	81	5.01e0	SMART
VWA	151	327	2.68e-32	SMART
Int_alpha	398	450	1.27e-6	SMART
Int_alpha	454	509	9.6e-7	SMART
Int_alpha	515	568	3.58e-15	SMART
Int_alpha	575	624	1.28e1	SMART
low complexity region	1043	1059	N/A	INTRINSIC
transmembrane domain	1087	1109	N/A	INTRINSIC
Pfam:Integrin_alpha	1110	1124	5.8e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000117762
AA Change: Y981C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000113946
Gene: ENSMUSG00000030830
AA Change: Y981C

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Int_alpha	38	81	5.01e0	SMART
VWA	151	327	2.68e-32	SMART
Int_alpha	398	450	1.27e-6	SMART
Int_alpha	454	509	9.6e-7	SMART
Int_alpha	515	568	3.58e-15	SMART
Int_alpha	575	624	1.28e1	SMART
low complexity region	1042	1058	N/A	INTRINSIC
transmembrane domain	1086	1108	N/A	INTRINSIC
Pfam:Integrin_alpha	1109	1123	5.8e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000118405
AA Change: Y585C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000112591
Gene: ENSMUSG00000030830
AA Change: Y585C

Domain	Start	End	E-Value	Type
Int_alpha	2	54	4.21e-3	SMART
Int_alpha	58	113	9.6e-7	SMART
Int_alpha	119	172	3.58e-15	SMART
Int_alpha	179	228	1.28e1	SMART
low complexity region	646	662	N/A	INTRINSIC
transmembrane domain	690	712	N/A	INTRINSIC
Pfam:Integrin_alpha	713	727	2.1e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000120857
AA Change: Y981C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000113396
Gene: ENSMUSG00000030830
AA Change: Y981C

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Int_alpha	38	81	5.01e0	SMART
VWA	151	327	2.68e-32	SMART
Int_alpha	398	450	1.27e-6	SMART
Int_alpha	454	509	9.6e-7	SMART
Int_alpha	515	568	3.58e-15	SMART
Int_alpha	575	624	1.28e1	SMART
low complexity region	1042	1058	N/A	INTRINSIC
transmembrane domain	1086	1108	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170971
AA Change: Y981C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000131847
Gene: ENSMUSG00000030830
AA Change: Y981C

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Int_alpha	38	81	5.01e0	SMART
VWA	151	327	2.68e-32	SMART
Int_alpha	398	450	1.27e-6	SMART
Int_alpha	454	509	9.6e-7	SMART
Int_alpha	515	568	3.58e-15	SMART
Int_alpha	575	624	1.28e1	SMART
low complexity region	1042	1058	N/A	INTRINSIC
transmembrane domain	1086	1108	N/A	INTRINSIC
Pfam:Integrin_alpha	1109	1123	1.2e-6	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ITGAL encodes the integrin alpha L chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form the integrin lymphocyte function-associated antigen-1 (LFA-1), which is expressed on all leukocytes. LFA-1 plays a central role in leukocyte intercellular adhesion through interactions with its ligands, ICAMs 1-3 (intercellular adhesion molecules 1 through 3), and also functions in lymphocyte costimulatory signaling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mutations of this gene lead to increased leukocyte cell number, alter T cell activation, leukocyte migration and adhesion, spleen and lymph node morphology, and may affect humoral immune responses, metastatic potential, and susceptibility to endotoxin shock. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	T	A	14: 49,770,436	T527S	probably damaging	Het
Adck5	A	G	15: 76,594,335		probably benign	Het
Arhgap22	A	G	14: 33,369,510	M681V	probably damaging	Het
Atp10d	T	C	5: 72,296,975	L189P	probably damaging	Het
BC034090	A	G	1: 155,232,450	C384R	probably benign	Het
C330007P06Rik	C	A	X: 36,824,159	C206F	probably benign	Het
Ccdc180	T	A	4: 45,941,877	L1380Q	probably damaging	Het
Cd209c	T	C	8: 3,954,635		noncoding transcript	Het
Cenpp	A	G	13: 49,494,431		probably benign	Het
Csf1	T	A	3: 107,756,739	T38S	probably damaging	Het
Csn1s2a	T	C	5: 87,775,821	V12A	probably benign	Het
Dapk1	A	G	13: 60,719,684	D235G	probably benign	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Frmd3	T	A	4: 74,128,298		probably null	Het
Gart	G	A	16: 91,634,094	A360V	probably benign	Het
Gm7251	T	A	13: 49,805,200		noncoding transcript	Het
Gon4l	C	A	3: 88,907,387	P1888T	probably benign	Het
Hk1	C	A	10: 62,315,540	K10N	probably damaging	Het
Kcp	C	T	6: 29,493,203	C107Y	probably damaging	Het
Kdm2a	C	T	19: 4,329,054	V138M	probably benign	Het
Kit	T	C	5: 75,640,499	I515T	probably benign	Het
Kmt2c	C	T	5: 25,315,326	V1929I	probably benign	Het
Krt33a	T	C	11: 100,012,427	E263G	possibly damaging	Het
Mark2	T	C	19: 7,290,689	I50V	possibly damaging	Het
Mug2	G	T	6: 122,071,007		probably null	Het
Mvk	A	G	5: 114,452,961		probably benign	Het
Myh6	T	A	14: 54,962,108	I249F	probably damaging	Het
Naa15	T	C	3: 51,448,365	I229T	possibly damaging	Het
Napb	A	C	2: 148,732,264		probably null	Het
Ncoa3	T	G	2: 166,054,497	L440R	possibly damaging	Het
Olfr608	T	C	7: 103,470,071	S11P	probably damaging	Het
Olfr965	T	A	9: 39,719,807	F193L	probably benign	Het
Osbpl8	T	A	10: 111,269,419	I245N	possibly damaging	Het
Pdia4	G	A	6: 47,798,392	R495W	probably damaging	Het
Pfn4	T	A	12: 4,770,182	D10E	probably damaging	Het
Plekha5	T	C	6: 140,579,465	Y376H	probably damaging	Het
Pole	T	A	5: 110,337,205	I395K	possibly damaging	Het
Prcc	A	G	3: 87,867,407	Y363H	probably damaging	Het
Ptprc	A	T	1: 138,067,925	M982K	probably benign	Het
Ptpro	T	A	6: 137,380,266	F252I	probably benign	Het
Pusl1	A	G	4: 155,890,580	V188A	probably benign	Het
Rad54l2	A	G	9: 106,693,222	S1300P	probably benign	Het
Rpl11	G	A	4: 136,051,143		probably benign	Het
Rtel1	T	A	2: 181,355,796	H1104Q	probably damaging	Het
Setbp1	T	C	18: 78,859,922	R177G	probably damaging	Het
Skint6	T	C	4: 113,236,518	T143A	possibly damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Zfp583	A	G	7: 6,317,681	S111P	possibly damaging	Het
Zmiz1	T	C	14: 25,636,010	S140P	probably damaging	Het

Other mutations in Itgal

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00987:Itgal	APN	7	127302011	missense	probably damaging	0.99
IGL01300:Itgal	APN	7	127314118	missense	probably damaging	1.00
IGL01345:Itgal	APN	7	127300956	missense	possibly damaging	0.56
IGL01826:Itgal	APN	7	127302146	missense	probably benign	0.16
IGL02202:Itgal	APN	7	127330179	nonsense	probably null
IGL02212:Itgal	APN	7	127300980	missense	probably benign	0.00
IGL02513:Itgal	APN	7	127328672	missense	possibly damaging	0.78
IGL02608:Itgal	APN	7	127310244	missense	probably damaging	1.00
IGL02946:Itgal	APN	7	127314368	missense	probably damaging	0.99
sunglow	UTSW	7	127328747	missense	probably null	0.89
R0069:Itgal	UTSW	7	127310331	missense	probably benign	0.44
R0069:Itgal	UTSW	7	127310331	missense	probably benign	0.44
R0107:Itgal	UTSW	7	127328559	splice site	probably benign
R0331:Itgal	UTSW	7	127306681	splice site	probably null
R0350:Itgal	UTSW	7	127322081	missense	probably damaging	1.00
R0380:Itgal	UTSW	7	127310751	nonsense	probably null
R0537:Itgal	UTSW	7	127311273	missense	possibly damaging	0.61
R0546:Itgal	UTSW	7	127310314	missense	probably benign	0.00
R0594:Itgal	UTSW	7	127314060	missense	probably damaging	1.00
R1167:Itgal	UTSW	7	127300939	missense	probably damaging	1.00
R1377:Itgal	UTSW	7	127321917	missense	probably damaging	1.00
R1575:Itgal	UTSW	7	127300888	critical splice acceptor site	probably null
R1690:Itgal	UTSW	7	127302117	missense	possibly damaging	0.56
R1693:Itgal	UTSW	7	127305281	missense	probably damaging	1.00
R1702:Itgal	UTSW	7	127305025	missense	probably benign	0.00
R1720:Itgal	UTSW	7	127306927	missense	probably benign	0.00
R1774:Itgal	UTSW	7	127309622	critical splice donor site	probably null
R1824:Itgal	UTSW	7	127314060	missense	probably damaging	1.00
R1878:Itgal	UTSW	7	127310671	missense	probably benign	0.44
R1951:Itgal	UTSW	7	127330145	missense	probably damaging	1.00
R2265:Itgal	UTSW	7	127306701	missense	possibly damaging	0.63
R2267:Itgal	UTSW	7	127306701	missense	possibly damaging	0.63
R2269:Itgal	UTSW	7	127306701	missense	possibly damaging	0.63
R2276:Itgal	UTSW	7	127328747	missense	probably null	0.89
R2570:Itgal	UTSW	7	127314096	missense	probably damaging	1.00
R3925:Itgal	UTSW	7	127324537	splice site	probably benign
R4225:Itgal	UTSW	7	127305312	missense	probably damaging	1.00
R4466:Itgal	UTSW	7	127328512	missense	possibly damaging	0.93
R4579:Itgal	UTSW	7	127305294	missense	possibly damaging	0.83
R4656:Itgal	UTSW	7	127322553	missense	probably damaging	1.00
R4771:Itgal	UTSW	7	127328233	missense	probably damaging	1.00
R5012:Itgal	UTSW	7	127299630	critical splice donor site	probably null
R5328:Itgal	UTSW	7	127311675	critical splice donor site	probably null
R5365:Itgal	UTSW	7	127305350	missense	probably damaging	0.98
R5579:Itgal	UTSW	7	127306929	missense	probably benign	0.10
R5849:Itgal	UTSW	7	127317320	missense	probably benign	0.27
R5955:Itgal	UTSW	7	127304989	missense	possibly damaging	0.82
R6254:Itgal	UTSW	7	127325203	missense	probably damaging	1.00
R6269:Itgal	UTSW	7	127330217	missense	probably null	1.00
R6520:Itgal	UTSW	7	127330331	missense	probably benign	0.01
R6541:Itgal	UTSW	7	127311562	missense	probably damaging	0.99
R7049:Itgal	UTSW	7	127296401	unclassified	probably benign
R7168:Itgal	UTSW	7	127330213	missense	probably benign
R7419:Itgal	UTSW	7	127306875	missense	probably benign	0.01
R7424:Itgal	UTSW	7	127317365	missense	probably benign	0.00
R7454:Itgal	UTSW	7	127327764	missense	probably benign	0.00
R7567:Itgal	UTSW	7	127299788	missense	probably benign	0.00
R7696:Itgal	UTSW	7	127330184	missense	probably damaging	1.00
R7977:Itgal	UTSW	7	127328298	missense	possibly damaging	0.88
R7987:Itgal	UTSW	7	127328298	missense	possibly damaging	0.88
R8118:Itgal	UTSW	7	127311245	missense	probably benign	0.08
R8297:Itgal	UTSW	7	127330466	missense	unknown
R8418:Itgal	UTSW	7	127330282	missense	probably benign	0.02
R8477:Itgal	UTSW	7	127300933	missense	probably damaging	1.00
R8507:Itgal	UTSW	7	127329435	missense	probably benign	0.26
R8789:Itgal	UTSW	7	127305249	missense	probably benign	0.05
R8838:Itgal	UTSW	7	127311261	missense	probably damaging	1.00
R8881:Itgal	UTSW	7	127330369	missense	probably benign	0.11
R8923:Itgal	UTSW	7	127296361	unclassified	probably benign
R9070:Itgal	UTSW	7	127328701	missense	probably null	0.98
R9104:Itgal	UTSW	7	127311622	missense	probably damaging	1.00
R9173:Itgal	UTSW	7	127297617	critical splice acceptor site	probably null
R9179:Itgal	UTSW	7	127306711	missense	probably benign	0.33
R9407:Itgal	UTSW	7	127322624	critical splice donor site	probably null
R9545:Itgal	UTSW	7	127330250	missense	probably damaging	1.00
R9681:Itgal	UTSW	7	127330250	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGTCTGTCATGATGCACTGC -3'
(R):5'- TTCCTACCTCACAGAACTCAGG -3'

Sequencing Primer
(F):5'- GTCATGATGCACTGCCTAGCTAAC -3'
(R):5'- AGAACTCAGGCATCTCCATTCTC -3'

Posted On

2015-07-06