Mutagenetix > Incidental Mutations

Incidental Mutation 'R4377:Rad54l2'

325154

Institutional Source

Beutler Lab

Gene Symbol

Rad54l2

Ensembl Gene

ENSMUSG00000040661

Gene Name

RAD54 like 2 (S. cerevisiae)

Synonyms

Srisnf2l, G630026H09Rik, Arip4

MMRRC Submission

041676-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4377 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

106688082-106789194 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 106693222 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1300 (S1300P)

Ref Sequence

ENSEMBL: ENSMUSP00000045454 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046502]

Predicted Effect

probably benign
Transcript: ENSMUST00000046502
AA Change: S1300P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000045454
Gene: ENSMUSG00000040661
AA Change: S1300P

Domain	Start	End	E-Value	Type
coiled coil region	20	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	130	146	N/A	INTRINSIC
low complexity region	186	200	N/A	INTRINSIC
low complexity region	215	229	N/A	INTRINSIC
DEXDc	267	520	4.21e-20	SMART
HELICc	751	854	1.88e-17	SMART
low complexity region	959	976	N/A	INTRINSIC
low complexity region	1348	1368	N/A	INTRINSIC
low complexity region	1453	1460	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000189553
AA Change: S28P

Meta Mutation Damage Score

0.0594

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

98% (57/58)

MGI Phenotype

PHENOTYPE: Homozygous null embryos show delayed growth, reduced cell proliferation, increased apoptosis and die by E11.5. At E9.5-E10.5, most major organs are smaller and the neural tube is shrunk in some cases. Mutant MEFs cease to grow after 2-3 passages showing increased apoptosis and reduced DNA synthesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	T	A	14: 49,770,436	T527S	probably damaging	Het
Adck5	A	G	15: 76,594,335		probably benign	Het
Arhgap22	A	G	14: 33,369,510	M681V	probably damaging	Het
Atp10d	T	C	5: 72,296,975	L189P	probably damaging	Het
BC034090	A	G	1: 155,232,450	C384R	probably benign	Het
C330007P06Rik	C	A	X: 36,824,159	C206F	probably benign	Het
Ccdc180	T	A	4: 45,941,877	L1380Q	probably damaging	Het
Cd209c	T	C	8: 3,954,635		noncoding transcript	Het
Cenpp	A	G	13: 49,494,431		probably benign	Het
Csf1	T	A	3: 107,756,739	T38S	probably damaging	Het
Csn1s2a	T	C	5: 87,775,821	V12A	probably benign	Het
Dapk1	A	G	13: 60,719,684	D235G	probably benign	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Frmd3	T	A	4: 74,128,298		probably null	Het
Gart	G	A	16: 91,634,094	A360V	probably benign	Het
Gm7251	T	A	13: 49,805,200		noncoding transcript	Het
Gon4l	C	A	3: 88,907,387	P1888T	probably benign	Het
Hk1	C	A	10: 62,315,540	K10N	probably damaging	Het
Itgal	A	G	7: 127,328,281	Y981C	probably benign	Het
Kcp	C	T	6: 29,493,203	C107Y	probably damaging	Het
Kdm2a	C	T	19: 4,329,054	V138M	probably benign	Het
Kit	T	C	5: 75,640,499	I515T	probably benign	Het
Kmt2c	C	T	5: 25,315,326	V1929I	probably benign	Het
Krt33a	T	C	11: 100,012,427	E263G	possibly damaging	Het
Mark2	T	C	19: 7,290,689	I50V	possibly damaging	Het
Mug2	G	T	6: 122,071,007		probably null	Het
Mvk	A	G	5: 114,452,961		probably benign	Het
Myh6	T	A	14: 54,962,108	I249F	probably damaging	Het
Naa15	T	C	3: 51,448,365	I229T	possibly damaging	Het
Napb	A	C	2: 148,732,264		probably null	Het
Ncoa3	T	G	2: 166,054,497	L440R	possibly damaging	Het
Olfr608	T	C	7: 103,470,071	S11P	probably damaging	Het
Olfr965	T	A	9: 39,719,807	F193L	probably benign	Het
Osbpl8	T	A	10: 111,269,419	I245N	possibly damaging	Het
Pdia4	G	A	6: 47,798,392	R495W	probably damaging	Het
Pfn4	T	A	12: 4,770,182	D10E	probably damaging	Het
Plekha5	T	C	6: 140,579,465	Y376H	probably damaging	Het
Pole	T	A	5: 110,337,205	I395K	possibly damaging	Het
Prcc	A	G	3: 87,867,407	Y363H	probably damaging	Het
Ptprc	A	T	1: 138,067,925	M982K	probably benign	Het
Ptpro	T	A	6: 137,380,266	F252I	probably benign	Het
Pusl1	A	G	4: 155,890,580	V188A	probably benign	Het
Rpl11	G	A	4: 136,051,143		probably benign	Het
Rtel1	T	A	2: 181,355,796	H1104Q	probably damaging	Het
Setbp1	T	C	18: 78,859,922	R177G	probably damaging	Het
Skint6	T	C	4: 113,236,518	T143A	possibly damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Zfp583	A	G	7: 6,317,681	S111P	possibly damaging	Het
Zmiz1	T	C	14: 25,636,010	S140P	probably damaging	Het

Other mutations in Rad54l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Rad54l2	APN	9	106700561	missense	probably benign
IGL00718:Rad54l2	APN	9	106713455	missense	probably damaging	1.00
IGL00917:Rad54l2	APN	9	106710439	missense	possibly damaging	0.95
IGL01319:Rad54l2	APN	9	106719046	missense	probably benign	0.18
IGL01447:Rad54l2	APN	9	106702772	missense	probably damaging	1.00
IGL01469:Rad54l2	APN	9	106722758	missense	probably damaging	1.00
IGL01836:Rad54l2	APN	9	106716157	missense	probably benign	0.00
IGL02017:Rad54l2	APN	9	106754040	missense	possibly damaging	0.85
IGL02179:Rad54l2	APN	9	106720390	missense	probably damaging	1.00
IGL02348:Rad54l2	APN	9	106720376	missense	probably damaging	1.00
IGL02822:Rad54l2	APN	9	106710407	missense	probably damaging	1.00
IGL03169:Rad54l2	APN	9	106719064	missense	probably benign	0.37
IGL03245:Rad54l2	APN	9	106703628	missense	probably damaging	1.00
IGL03253:Rad54l2	APN	9	106704223	missense	probably damaging	1.00
IGL02988:Rad54l2	UTSW	9	106700585	missense	probably benign
PIT4495001:Rad54l2	UTSW	9	106716144	missense	probably benign	0.02
R0001:Rad54l2	UTSW	9	106708217	missense	probably damaging	0.97
R0069:Rad54l2	UTSW	9	106710365	missense	possibly damaging	0.67
R0069:Rad54l2	UTSW	9	106710365	missense	possibly damaging	0.67
R0114:Rad54l2	UTSW	9	106713455	missense	probably damaging	1.00
R0427:Rad54l2	UTSW	9	106693692	missense	possibly damaging	0.65
R0519:Rad54l2	UTSW	9	106708299	missense	probably damaging	0.98
R0760:Rad54l2	UTSW	9	106719606	critical splice donor site	probably null
R1018:Rad54l2	UTSW	9	106712390	missense	probably benign	0.32
R1630:Rad54l2	UTSW	9	106703629	missense	possibly damaging	0.79
R1701:Rad54l2	UTSW	9	106700493	critical splice donor site	probably null
R1903:Rad54l2	UTSW	9	106693717	splice site	probably null
R2187:Rad54l2	UTSW	9	106753992	small deletion	probably benign
R2205:Rad54l2	UTSW	9	106717798	missense	probably damaging	1.00
R2566:Rad54l2	UTSW	9	106703626	missense	possibly damaging	0.95
R2983:Rad54l2	UTSW	9	106700590	missense	probably benign	0.10
R3176:Rad54l2	UTSW	9	106753943	critical splice donor site	probably null
R3276:Rad54l2	UTSW	9	106753943	critical splice donor site	probably null
R3718:Rad54l2	UTSW	9	106693527	missense	probably benign
R4063:Rad54l2	UTSW	9	106720414	missense	probably benign	0.10
R4206:Rad54l2	UTSW	9	106717795	missense	probably damaging	1.00
R4271:Rad54l2	UTSW	9	106693626	missense	probably benign	0.22
R4700:Rad54l2	UTSW	9	106754025	missense	possibly damaging	0.85
R4729:Rad54l2	UTSW	9	106716118	missense	probably benign
R4872:Rad54l2	UTSW	9	106717892	missense	probably damaging	1.00
R4997:Rad54l2	UTSW	9	106722909	missense	possibly damaging	0.70
R5475:Rad54l2	UTSW	9	106705858	missense	probably damaging	1.00
R5658:Rad54l2	UTSW	9	106753992	small deletion	probably benign
R6246:Rad54l2	UTSW	9	106700493	critical splice donor site	probably null
R6248:Rad54l2	UTSW	9	106710338	missense	probably damaging	1.00
R6329:Rad54l2	UTSW	9	106717922	missense	possibly damaging	0.89
R6631:Rad54l2	UTSW	9	106713540	nonsense	probably null
R6773:Rad54l2	UTSW	9	106693317	missense	probably benign
R7148:Rad54l2	UTSW	9	106719119	nonsense	probably null
R7171:Rad54l2	UTSW	9	106713478	missense	probably damaging	1.00
R7226:Rad54l2	UTSW	9	106713472	missense	probably damaging	0.99
R7327:Rad54l2	UTSW	9	106693461	missense	possibly damaging	0.68
R7337:Rad54l2	UTSW	9	106705825	missense	probably damaging	1.00
R7636:Rad54l2	UTSW	9	106720387	missense	probably damaging	1.00
R7659:Rad54l2	UTSW	9	106713578	missense	probably benign	0.11
R7713:Rad54l2	UTSW	9	106717223	missense	probably damaging	1.00
R7748:Rad54l2	UTSW	9	106719034	missense	possibly damaging	0.53
R8021:Rad54l2	UTSW	9	106719641	missense	probably benign	0.00
R8084:Rad54l2	UTSW	9	106713502	missense	possibly damaging	0.63
R8552:Rad54l2	UTSW	9	106693578	missense	possibly damaging	0.77
R8768:Rad54l2	UTSW	9	106719610	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- AAAGGCGCAAACATCCTGG -3'
(R):5'- AGTTCCCTCTTGGTGACTGG -3'

Sequencing Primer
(F):5'- AAACATCCTGGGCTCGGACAG -3'
(R):5'- TCTTGGTGACTGGCCAGC -3'

Posted On

2015-07-06