Mutagenetix > Incidental Mutation

Incidental Mutation 'R4377:Top2b'

325162

Institutional Source

Beutler Lab

Gene Symbol

Top2b

Ensembl Gene

ENSMUSG00000017485

Gene Name

topoisomerase (DNA) II beta

Synonyms

D230016L12Rik, Top-2

MMRRC Submission

041676-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.904) question?

Stock #

R4377 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

16365179-16435462 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 16409189 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 777 (I777M)

Ref Sequence

ENSEMBL: ENSMUSP00000017629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017629] [ENSMUST00000161693]

AlphaFold

Q64511

Predicted Effect

probably damaging
Transcript: ENSMUST00000017629
AA Change: I777M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: I777M

Domain	Start	End	E-Value	Type
Blast:TOP2c	32	70	7e-10	BLAST
HATPase_c	85	234	1.91e-2	SMART
TOP2c	89	679	N/A	SMART
TOP4c	702	1175	2.55e-230	SMART
low complexity region	1201	1215	N/A	INTRINSIC
low complexity region	1287	1299	N/A	INTRINSIC
low complexity region	1324	1336	N/A	INTRINSIC
low complexity region	1360	1382	N/A	INTRINSIC
Pfam:DTHCT	1495	1597	4.6e-31	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159302

SMART Domains

Protein: ENSMUSP00000123789
Gene: ENSMUSG00000017485

Domain	Start	End	E-Value	Type
TOP4c	1	177	4.06e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160501

SMART Domains

Protein: ENSMUSP00000124889
Gene: ENSMUSG00000017485

Domain	Start	End	E-Value	Type
TOP4c	2	222	3.97e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000161693

SMART Domains

Protein: ENSMUSP00000123992
Gene: ENSMUSG00000017485

Domain	Start	End	E-Value	Type
Pfam:DNA_topoisoIV	1	117	1.2e-12	PFAM
low complexity region	161	173	N/A	INTRINSIC
low complexity region	198	210	N/A	INTRINSIC
low complexity region	234	256	N/A	INTRINSIC

Meta Mutation Damage Score

0.8018

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	T	A	14: 49,770,436	T527S	probably damaging	Het
Adck5	A	G	15: 76,594,335		probably benign	Het
Arhgap22	A	G	14: 33,369,510	M681V	probably damaging	Het
Atp10d	T	C	5: 72,296,975	L189P	probably damaging	Het
BC034090	A	G	1: 155,232,450	C384R	probably benign	Het
C330007P06Rik	C	A	X: 36,824,159	C206F	probably benign	Het
Ccdc180	T	A	4: 45,941,877	L1380Q	probably damaging	Het
Cd209c	T	C	8: 3,954,635		noncoding transcript	Het
Cenpp	A	G	13: 49,494,431		probably benign	Het
Csf1	T	A	3: 107,756,739	T38S	probably damaging	Het
Csn1s2a	T	C	5: 87,775,821	V12A	probably benign	Het
Dapk1	A	G	13: 60,719,684	D235G	probably benign	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Frmd3	T	A	4: 74,128,298		probably null	Het
Gart	G	A	16: 91,634,094	A360V	probably benign	Het
Gm7251	T	A	13: 49,805,200		noncoding transcript	Het
Gon4l	C	A	3: 88,907,387	P1888T	probably benign	Het
Hk1	C	A	10: 62,315,540	K10N	probably damaging	Het
Itgal	A	G	7: 127,328,281	Y981C	probably benign	Het
Kcp	C	T	6: 29,493,203	C107Y	probably damaging	Het
Kdm2a	C	T	19: 4,329,054	V138M	probably benign	Het
Kit	T	C	5: 75,640,499	I515T	probably benign	Het
Kmt2c	C	T	5: 25,315,326	V1929I	probably benign	Het
Krt33a	T	C	11: 100,012,427	E263G	possibly damaging	Het
Mark2	T	C	19: 7,290,689	I50V	possibly damaging	Het
Mug2	G	T	6: 122,071,007		probably null	Het
Mvk	A	G	5: 114,452,961		probably benign	Het
Myh6	T	A	14: 54,962,108	I249F	probably damaging	Het
Naa15	T	C	3: 51,448,365	I229T	possibly damaging	Het
Napb	A	C	2: 148,732,264		probably null	Het
Ncoa3	T	G	2: 166,054,497	L440R	possibly damaging	Het
Olfr608	T	C	7: 103,470,071	S11P	probably damaging	Het
Olfr965	T	A	9: 39,719,807	F193L	probably benign	Het
Osbpl8	T	A	10: 111,269,419	I245N	possibly damaging	Het
Pdia4	G	A	6: 47,798,392	R495W	probably damaging	Het
Pfn4	T	A	12: 4,770,182	D10E	probably damaging	Het
Plekha5	T	C	6: 140,579,465	Y376H	probably damaging	Het
Pole	T	A	5: 110,337,205	I395K	possibly damaging	Het
Prcc	A	G	3: 87,867,407	Y363H	probably damaging	Het
Ptprc	A	T	1: 138,067,925	M982K	probably benign	Het
Ptpro	T	A	6: 137,380,266	F252I	probably benign	Het
Pusl1	A	G	4: 155,890,580	V188A	probably benign	Het
Rad54l2	A	G	9: 106,693,222	S1300P	probably benign	Het
Rpl11	G	A	4: 136,051,143		probably benign	Het
Rtel1	T	A	2: 181,355,796	H1104Q	probably damaging	Het
Setbp1	T	C	18: 78,859,922	R177G	probably damaging	Het
Skint6	T	C	4: 113,236,518	T143A	possibly damaging	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Zfp583	A	G	7: 6,317,681	S111P	possibly damaging	Het
Zmiz1	T	C	14: 25,636,010	S140P	probably damaging	Het

Other mutations in Top2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Top2b	APN	14	16422692	missense	probably benign	0.00
IGL00730:Top2b	APN	14	16389831	missense	probably damaging	1.00
IGL00917:Top2b	APN	14	16407354	missense	probably benign	0.05
IGL01959:Top2b	APN	14	16422695	missense	probably benign	0.19
IGL02019:Top2b	APN	14	16409965	missense	probably benign	0.44
IGL02119:Top2b	APN	14	16406733	missense	probably damaging	1.00
IGL02136:Top2b	APN	14	16407103	unclassified	probably benign
IGL02148:Top2b	APN	14	16400488	missense	probably damaging	1.00
IGL02496:Top2b	APN	14	16387335	missense	probably benign
IGL02503:Top2b	APN	14	16407163	missense	possibly damaging	0.92
IGL02672:Top2b	APN	14	16409166	unclassified	probably benign
IGL02721:Top2b	APN	14	16409236	missense	probably damaging	1.00
IGL02886:Top2b	APN	14	16365688	missense	possibly damaging	0.73
IGL03252:Top2b	APN	14	16393163	missense	possibly damaging	0.60
PIT4434001:Top2b	UTSW	14	16423780	critical splice donor site	probably null
R0092:Top2b	UTSW	14	16409263	missense	probably damaging	1.00
R0201:Top2b	UTSW	14	16383174	missense	probably damaging	1.00
R0390:Top2b	UTSW	14	16418442	missense	probably benign	0.00
R0394:Top2b	UTSW	14	16413556	splice site	probably null
R1159:Top2b	UTSW	14	16430329	missense	possibly damaging	0.81
R1424:Top2b	UTSW	14	16383177	missense	probably damaging	1.00
R1519:Top2b	UTSW	14	16408953	splice site	probably null
R1561:Top2b	UTSW	14	16398993	missense	possibly damaging	0.80
R1713:Top2b	UTSW	14	16409823	missense	probably benign	0.05
R1987:Top2b	UTSW	14	16398916	missense	probably damaging	0.99
R2219:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2287:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2422:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2679:Top2b	UTSW	14	16413947	missense	probably damaging	1.00
R3687:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3707:Top2b	UTSW	14	16388447	missense	probably damaging	1.00
R3810:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3812:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3815:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3816:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3818:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4023:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4025:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4026:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4133:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4157:Top2b	UTSW	14	16384491	missense	probably benign	0.42
R4179:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4180:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4300:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4376:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4492:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4549:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4550:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4581:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4582:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4628:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4630:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4667:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4668:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4669:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4698:Top2b	UTSW	14	16387331	nonsense	probably null
R4769:Top2b	UTSW	14	16398991	missense	probably damaging	1.00
R4809:Top2b	UTSW	14	16383125	missense	probably benign	0.06
R4899:Top2b	UTSW	14	16387313	missense	probably damaging	1.00
R5035:Top2b	UTSW	14	16409966	missense	probably benign	0.01
R5621:Top2b	UTSW	14	16387280	missense	probably damaging	1.00
R5631:Top2b	UTSW	14	16409882	missense	probably damaging	1.00
R5685:Top2b	UTSW	14	16413666	missense	probably damaging	1.00
R5732:Top2b	UTSW	14	16400106	missense	possibly damaging	0.92
R5939:Top2b	UTSW	14	16422786	missense	probably damaging	0.96
R6007:Top2b	UTSW	14	16423779	critical splice donor site	probably null
R6087:Top2b	UTSW	14	16409864	missense	probably benign	0.14
R6144:Top2b	UTSW	14	16423740	missense	possibly damaging	0.48
R6196:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6218:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6229:Top2b	UTSW	14	16409838	missense	probably damaging	1.00
R6249:Top2b	UTSW	14	16399006	missense	probably damaging	1.00
R6337:Top2b	UTSW	14	16399026	missense	possibly damaging	0.77
R6353:Top2b	UTSW	14	16416671	missense	probably damaging	1.00
R6512:Top2b	UTSW	14	16409854	missense	possibly damaging	0.94
R6573:Top2b	UTSW	14	16398991	missense	probably damaging	1.00
R6614:Top2b	UTSW	14	16407142	nonsense	probably null
R6844:Top2b	UTSW	14	16429383	missense	possibly damaging	0.94
R6848:Top2b	UTSW	14	16409958	missense	possibly damaging	0.89
R6871:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6895:Top2b	UTSW	14	16413604	missense	probably benign	0.06
R7162:Top2b	UTSW	14	16416653	missense	probably benign	0.00
R7247:Top2b	UTSW	14	16416962	missense	probably benign	0.08
R7250:Top2b	UTSW	14	16420411	missense	probably benign
R7359:Top2b	UTSW	14	16407376	missense	probably null	1.00
R7365:Top2b	UTSW	14	16416649	missense	probably benign	0.04
R7493:Top2b	UTSW	14	16416605	missense	probably benign	0.00
R7528:Top2b	UTSW	14	16395427	nonsense	probably null
R7562:Top2b	UTSW	14	16412946	missense	probably benign	0.04
R7594:Top2b	UTSW	14	16428587	missense	probably benign
R7670:Top2b	UTSW	14	16416620	missense	possibly damaging	0.61
R7894:Top2b	UTSW	14	16413081	missense	possibly damaging	0.68
R8031:Top2b	UTSW	14	16412986	missense	probably damaging	0.98
R8150:Top2b	UTSW	14	16393291	missense	probably damaging	0.99
R8214:Top2b	UTSW	14	16383177	missense	probably damaging	1.00
R8299:Top2b	UTSW	14	16386123	missense	possibly damaging	0.68
R8977:Top2b	UTSW	14	16393239	missense	probably benign	0.36
R9562:Top2b	UTSW	14	16365718	missense	probably benign	0.09
R9565:Top2b	UTSW	14	16365718	missense	probably benign	0.09
R9798:Top2b	UTSW	14	16389845	missense	probably damaging	1.00
X0028:Top2b	UTSW	14	16384499	nonsense	probably null
Z1176:Top2b	UTSW	14	16395434	missense	probably damaging	1.00
Z1177:Top2b	UTSW	14	16416953	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CACCATGGAGAAGTAAGCACTG -3'
(R):5'- TTTGAAGTACTCTCCCTGAGCAG -3'

Sequencing Primer
(F):5'- GCACTGAAGATGGGATCAACTG -3'
(R):5'- TCTCCCTGAGCAGAAAAACTAAATG -3'

Posted On

2015-07-06