Incidental Mutation 'R4377:Kdm2a'
ID 325173
Institutional Source Beutler Lab
Gene Symbol Kdm2a
Ensembl Gene ENSMUSG00000054611
Gene Name lysine (K)-specific demethylase 2A
Synonyms Fbxl11, lalina, Fbl7, 5530401A10Rik, Gm4560, Cxxc8, Jhdm1a
MMRRC Submission 041676-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.966) question?
Stock # R4377 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 4366172-4448749 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 4379082 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 138 (V138M)
Ref Sequence ENSEMBL: ENSMUSP00000135745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047898] [ENSMUST00000075856] [ENSMUST00000176497] [ENSMUST00000176653]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000047898
AA Change: V578M

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000047683
Gene: ENSMUSG00000054611
AA Change: V578M

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
JmjC 148 316 1.52e-34 SMART
low complexity region 416 433 N/A INTRINSIC
PDB:2YU2|A 440 517 1e-35 PDB
Pfam:zf-CXXC 563 609 7.5e-16 PFAM
PHD 619 676 3.25e-4 SMART
low complexity region 848 875 N/A INTRINSIC
FBOX 892 932 1.58e-2 SMART
low complexity region 987 998 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075856
AA Change: V578M

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000076698
Gene: ENSMUSG00000054611
AA Change: V578M

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
JmjC 148 316 1.52e-34 SMART
low complexity region 416 433 N/A INTRINSIC
PDB:2YU2|A 440 517 1e-35 PDB
Pfam:zf-CXXC 563 609 7.5e-16 PFAM
PHD 619 676 3.25e-4 SMART
low complexity region 848 875 N/A INTRINSIC
FBOX 892 932 1.58e-2 SMART
low complexity region 987 998 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176497
SMART Domains Protein: ENSMUSP00000135471
Gene: ENSMUSG00000054611

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176653
AA Change: V138M

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000135745
Gene: ENSMUSG00000054611
AA Change: V138M

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
PDB:2YU2|A 52 77 4e-7 PDB
Pfam:zf-CXXC 123 169 3e-16 PFAM
PHD 179 236 3.25e-4 SMART
Meta Mutation Damage Score 0.0577 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains at least six highly degenerated leucine-rich repeats. This family member plays a role in epigenetic silencing. It nucleates at CpG islands and specifically demethylates both mono- and di-methylated lysine-36 of histone H3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele show embryonic lethality, severe growth retardation, reduced neuron proliferation, increased neuron apoptosis, impaired neuron differentiation, small hearts, abnormal cardiac looping and, in some cases, incomplete embryonic turning and neural tube closure defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck5 A G 15: 76,478,535 (GRCm39) probably benign Het
Arhgap22 A G 14: 33,091,467 (GRCm39) M681V probably damaging Het
Armh4 T A 14: 50,007,893 (GRCm39) T527S probably damaging Het
Atp10d T C 5: 72,454,318 (GRCm39) L189P probably damaging Het
BC034090 A G 1: 155,108,196 (GRCm39) C384R probably benign Het
Ccdc180 T A 4: 45,941,877 (GRCm39) L1380Q probably damaging Het
Cd209c T C 8: 4,004,635 (GRCm39) noncoding transcript Het
Cenpp A G 13: 49,647,907 (GRCm39) probably benign Het
Csf1 T A 3: 107,664,055 (GRCm39) T38S probably damaging Het
Csn1s2a T C 5: 87,923,680 (GRCm39) V12A probably benign Het
Dapk1 A G 13: 60,867,498 (GRCm39) D235G probably benign Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Frmd3 T A 4: 74,046,535 (GRCm39) probably null Het
Gart G A 16: 91,430,982 (GRCm39) A360V probably benign Het
Gm7251 T A 13: 49,958,676 (GRCm39) noncoding transcript Het
Gon4l C A 3: 88,814,694 (GRCm39) P1888T probably benign Het
Hk1 C A 10: 62,151,319 (GRCm39) K10N probably damaging Het
Itgal A G 7: 126,927,453 (GRCm39) Y981C probably benign Het
Kcp C T 6: 29,493,202 (GRCm39) C107Y probably damaging Het
Kit T C 5: 75,801,159 (GRCm39) I515T probably benign Het
Kmt2c C T 5: 25,520,324 (GRCm39) V1929I probably benign Het
Krt33a T C 11: 99,903,253 (GRCm39) E263G possibly damaging Het
Mark2 T C 19: 7,268,054 (GRCm39) I50V possibly damaging Het
Mug2 G T 6: 122,047,966 (GRCm39) probably null Het
Mvk A G 5: 114,591,022 (GRCm39) probably benign Het
Myh6 T A 14: 55,199,565 (GRCm39) I249F probably damaging Het
Naa15 T C 3: 51,355,786 (GRCm39) I229T possibly damaging Het
Napb A C 2: 148,574,184 (GRCm39) probably null Het
Ncoa3 T G 2: 165,896,417 (GRCm39) L440R possibly damaging Het
Or52ae7 T C 7: 103,119,278 (GRCm39) S11P probably damaging Het
Or8g52 T A 9: 39,631,103 (GRCm39) F193L probably benign Het
Osbpl8 T A 10: 111,105,280 (GRCm39) I245N possibly damaging Het
Pdia4 G A 6: 47,775,326 (GRCm39) R495W probably damaging Het
Pfn4 T A 12: 4,820,182 (GRCm39) D10E probably damaging Het
Plekha5 T C 6: 140,525,191 (GRCm39) Y376H probably damaging Het
Pole T A 5: 110,485,071 (GRCm39) I395K possibly damaging Het
Prcc A G 3: 87,774,714 (GRCm39) Y363H probably damaging Het
Ptprc A T 1: 137,995,663 (GRCm39) M982K probably benign Het
Ptpro T A 6: 137,357,264 (GRCm39) F252I probably benign Het
Pusl1 A G 4: 155,975,037 (GRCm39) V188A probably benign Het
Rad54l2 A G 9: 106,570,421 (GRCm39) S1300P probably benign Het
Rpl11 G A 4: 135,778,454 (GRCm39) probably benign Het
Rtel1 T A 2: 180,997,589 (GRCm39) H1104Q probably damaging Het
Setbp1 T C 18: 78,903,137 (GRCm39) R177G probably damaging Het
Skint6 T C 4: 113,093,715 (GRCm39) T143A possibly damaging Het
Steep1 C A X: 36,087,812 (GRCm39) C206F probably benign Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,648 (GRCm39) probably benign Het
Ttc23l G A 15: 10,537,652 (GRCm39) S206L probably benign Het
Zfp583 A G 7: 6,320,680 (GRCm39) S111P possibly damaging Het
Zmiz1 T C 14: 25,636,434 (GRCm39) S140P probably damaging Het
Other mutations in Kdm2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Kdm2a APN 19 4,406,926 (GRCm39) missense possibly damaging 0.94
IGL00679:Kdm2a APN 19 4,376,869 (GRCm39) missense probably damaging 1.00
IGL01104:Kdm2a APN 19 4,406,766 (GRCm39) splice site probably benign
IGL01161:Kdm2a APN 19 4,369,279 (GRCm39) missense probably benign 0.04
IGL01433:Kdm2a APN 19 4,392,888 (GRCm39) missense possibly damaging 0.83
IGL01456:Kdm2a APN 19 4,401,783 (GRCm39) missense probably damaging 1.00
IGL01467:Kdm2a APN 19 4,374,435 (GRCm39) missense probably damaging 0.99
IGL01517:Kdm2a APN 19 4,412,089 (GRCm39) splice site probably benign
IGL01528:Kdm2a APN 19 4,393,083 (GRCm39) missense probably benign 0.18
IGL02504:Kdm2a APN 19 4,406,799 (GRCm39) missense possibly damaging 0.92
IGL02895:Kdm2a APN 19 4,412,930 (GRCm39) missense probably damaging 1.00
IGL03109:Kdm2a APN 19 4,379,135 (GRCm39) missense probably benign 0.04
IGL03171:Kdm2a APN 19 4,406,792 (GRCm39) missense probably damaging 1.00
IGL03256:Kdm2a APN 19 4,395,538 (GRCm39) unclassified probably benign
BB009:Kdm2a UTSW 19 4,369,184 (GRCm39) missense probably damaging 0.98
BB019:Kdm2a UTSW 19 4,369,184 (GRCm39) missense probably damaging 0.98
P0027:Kdm2a UTSW 19 4,393,273 (GRCm39) splice site probably benign
PIT4382001:Kdm2a UTSW 19 4,393,201 (GRCm39) missense probably benign
R0220:Kdm2a UTSW 19 4,374,947 (GRCm39) missense possibly damaging 0.85
R0961:Kdm2a UTSW 19 4,379,219 (GRCm39) missense probably benign 0.07
R1662:Kdm2a UTSW 19 4,378,240 (GRCm39) missense probably damaging 1.00
R2023:Kdm2a UTSW 19 4,372,492 (GRCm39) missense probably damaging 0.98
R2191:Kdm2a UTSW 19 4,406,959 (GRCm39) splice site probably null
R2207:Kdm2a UTSW 19 4,412,898 (GRCm39) missense probably damaging 1.00
R2351:Kdm2a UTSW 19 4,379,154 (GRCm39) missense probably benign 0.02
R2406:Kdm2a UTSW 19 4,372,546 (GRCm39) missense probably damaging 1.00
R2882:Kdm2a UTSW 19 4,381,212 (GRCm39) critical splice donor site probably null
R3788:Kdm2a UTSW 19 4,401,833 (GRCm39) missense probably damaging 0.99
R3792:Kdm2a UTSW 19 4,374,540 (GRCm39) missense possibly damaging 0.91
R3950:Kdm2a UTSW 19 4,393,260 (GRCm39) missense possibly damaging 0.89
R4235:Kdm2a UTSW 19 4,372,549 (GRCm39) missense probably damaging 0.98
R4466:Kdm2a UTSW 19 4,370,328 (GRCm39) missense probably damaging 0.99
R4766:Kdm2a UTSW 19 4,374,535 (GRCm39) unclassified probably benign
R4824:Kdm2a UTSW 19 4,412,815 (GRCm39) missense probably damaging 1.00
R4838:Kdm2a UTSW 19 4,375,054 (GRCm39) missense probably benign 0.41
R5283:Kdm2a UTSW 19 4,381,297 (GRCm39) missense probably benign 0.00
R6366:Kdm2a UTSW 19 4,374,960 (GRCm39) missense probably benign 0.15
R6368:Kdm2a UTSW 19 4,400,345 (GRCm39) missense probably damaging 1.00
R6522:Kdm2a UTSW 19 4,374,854 (GRCm39) missense possibly damaging 0.49
R6716:Kdm2a UTSW 19 4,379,130 (GRCm39) missense probably damaging 1.00
R6757:Kdm2a UTSW 19 4,369,271 (GRCm39) missense probably damaging 0.98
R6912:Kdm2a UTSW 19 4,372,529 (GRCm39) missense probably benign 0.06
R6996:Kdm2a UTSW 19 4,395,669 (GRCm39) missense probably benign 0.16
R7090:Kdm2a UTSW 19 4,369,169 (GRCm39) missense probably damaging 1.00
R7497:Kdm2a UTSW 19 4,374,404 (GRCm39) missense probably damaging 1.00
R7542:Kdm2a UTSW 19 4,383,858 (GRCm39) start gained probably benign
R7932:Kdm2a UTSW 19 4,369,184 (GRCm39) missense probably damaging 0.98
R8199:Kdm2a UTSW 19 4,439,054 (GRCm39) missense unknown
R8263:Kdm2a UTSW 19 4,374,392 (GRCm39) missense possibly damaging 0.88
R8446:Kdm2a UTSW 19 4,406,916 (GRCm39) nonsense probably null
R9158:Kdm2a UTSW 19 4,374,715 (GRCm39) missense possibly damaging 0.49
R9303:Kdm2a UTSW 19 4,395,606 (GRCm39) missense probably benign 0.01
R9314:Kdm2a UTSW 19 4,372,510 (GRCm39) missense probably damaging 1.00
R9351:Kdm2a UTSW 19 4,393,141 (GRCm39) missense
R9353:Kdm2a UTSW 19 4,393,141 (GRCm39) missense
R9411:Kdm2a UTSW 19 4,412,835 (GRCm39) missense probably damaging 0.99
R9456:Kdm2a UTSW 19 4,393,141 (GRCm39) missense
R9616:Kdm2a UTSW 19 4,370,308 (GRCm39) missense probably damaging 0.99
R9625:Kdm2a UTSW 19 4,393,141 (GRCm39) missense
RF046:Kdm2a UTSW 19 4,374,535 (GRCm39) unclassified probably benign
X0028:Kdm2a UTSW 19 4,398,774 (GRCm39) missense probably damaging 1.00
X0028:Kdm2a UTSW 19 4,370,299 (GRCm39) missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AACCCATCTCAGTTAAGTCTCC -3'
(R):5'- AGCAGCTGGATATAGTTGACC -3'

Sequencing Primer
(F):5'- CATCTCAGTTAAGTCTCCCTGAC -3'
(R):5'- CTGGATATAGTTGACCATGCTTTTC -3'
Posted On 2015-07-06