Mutagenetix > Incidental Mutation

Incidental Mutation 'R4377:Kdm2a'

325173

Institutional Source

Beutler Lab

Gene Symbol

Kdm2a

Ensembl Gene

ENSMUSG00000054611

Gene Name

lysine (K)-specific demethylase 2A

Synonyms

Gm4560, lalina, Fbl7, Jhdm1a, Cxxc8, Fbxl11, 5530401A10Rik

MMRRC Submission

041676-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R4377 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4314419-4398285 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 4329054 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 138 (V138M)

Ref Sequence

ENSEMBL: ENSMUSP00000135745 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047898] [ENSMUST00000075856] [ENSMUST00000176497] [ENSMUST00000176653]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000047898
AA Change: V578M

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000047683
Gene: ENSMUSG00000054611
AA Change: V578M

Domain	Start	End	E-Value	Type
low complexity region	23	34	N/A	INTRINSIC
low complexity region	127	138	N/A	INTRINSIC
JmjC	148	316	1.52e-34	SMART
low complexity region	416	433	N/A	INTRINSIC
PDB:2YU2\|A	440	517	1e-35	PDB
Pfam:zf-CXXC	563	609	7.5e-16	PFAM
PHD	619	676	3.25e-4	SMART
low complexity region	848	875	N/A	INTRINSIC
FBOX	892	932	1.58e-2	SMART
low complexity region	987	998	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000075856
AA Change: V578M

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000076698
Gene: ENSMUSG00000054611
AA Change: V578M

Domain	Start	End	E-Value	Type
low complexity region	23	34	N/A	INTRINSIC
low complexity region	127	138	N/A	INTRINSIC
JmjC	148	316	1.52e-34	SMART
low complexity region	416	433	N/A	INTRINSIC
PDB:2YU2\|A	440	517	1e-35	PDB
Pfam:zf-CXXC	563	609	7.5e-16	PFAM
PHD	619	676	3.25e-4	SMART
low complexity region	848	875	N/A	INTRINSIC
FBOX	892	932	1.58e-2	SMART
low complexity region	987	998	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176497

SMART Domains

Protein: ENSMUSP00000135471
Gene: ENSMUSG00000054611

Domain	Start	End	E-Value	Type
low complexity region	24	35	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176653
AA Change: V138M

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000135745
Gene: ENSMUSG00000054611
AA Change: V138M

Domain	Start	End	E-Value	Type
low complexity region	24	35	N/A	INTRINSIC
PDB:2YU2\|A	52	77	4e-7	PDB
Pfam:zf-CXXC	123	169	3e-16	PFAM
PHD	179	236	3.25e-4	SMART

Meta Mutation Damage Score

0.0577

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains at least six highly degenerated leucine-rich repeats. This family member plays a role in epigenetic silencing. It nucleates at CpG islands and specifically demethylates both mono- and di-methylated lysine-36 of histone H3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele show embryonic lethality, severe growth retardation, reduced neuron proliferation, increased neuron apoptosis, impaired neuron differentiation, small hearts, abnormal cardiac looping and, in some cases, incomplete embryonic turning and neural tube closure defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	T	A	14: 49,770,436	T527S	probably damaging	Het
Adck5	A	G	15: 76,594,335		probably benign	Het
Arhgap22	A	G	14: 33,369,510	M681V	probably damaging	Het
Atp10d	T	C	5: 72,296,975	L189P	probably damaging	Het
BC034090	A	G	1: 155,232,450	C384R	probably benign	Het
C330007P06Rik	C	A	X: 36,824,159	C206F	probably benign	Het
Ccdc180	T	A	4: 45,941,877	L1380Q	probably damaging	Het
Cd209c	T	C	8: 3,954,635		noncoding transcript	Het
Cenpp	A	G	13: 49,494,431		probably benign	Het
Csf1	T	A	3: 107,756,739	T38S	probably damaging	Het
Csn1s2a	T	C	5: 87,775,821	V12A	probably benign	Het
Dapk1	A	G	13: 60,719,684	D235G	probably benign	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Frmd3	T	A	4: 74,128,298		probably null	Het
Gart	G	A	16: 91,634,094	A360V	probably benign	Het
Gm7251	T	A	13: 49,805,200		noncoding transcript	Het
Gon4l	C	A	3: 88,907,387	P1888T	probably benign	Het
Hk1	C	A	10: 62,315,540	K10N	probably damaging	Het
Itgal	A	G	7: 127,328,281	Y981C	probably benign	Het
Kcp	C	T	6: 29,493,203	C107Y	probably damaging	Het
Kit	T	C	5: 75,640,499	I515T	probably benign	Het
Kmt2c	C	T	5: 25,315,326	V1929I	probably benign	Het
Krt33a	T	C	11: 100,012,427	E263G	possibly damaging	Het
Mark2	T	C	19: 7,290,689	I50V	possibly damaging	Het
Mug2	G	T	6: 122,071,007		probably null	Het
Mvk	A	G	5: 114,452,961		probably benign	Het
Myh6	T	A	14: 54,962,108	I249F	probably damaging	Het
Naa15	T	C	3: 51,448,365	I229T	possibly damaging	Het
Napb	A	C	2: 148,732,264		probably null	Het
Ncoa3	T	G	2: 166,054,497	L440R	possibly damaging	Het
Olfr608	T	C	7: 103,470,071	S11P	probably damaging	Het
Olfr965	T	A	9: 39,719,807	F193L	probably benign	Het
Osbpl8	T	A	10: 111,269,419	I245N	possibly damaging	Het
Pdia4	G	A	6: 47,798,392	R495W	probably damaging	Het
Pfn4	T	A	12: 4,770,182	D10E	probably damaging	Het
Plekha5	T	C	6: 140,579,465	Y376H	probably damaging	Het
Pole	T	A	5: 110,337,205	I395K	possibly damaging	Het
Prcc	A	G	3: 87,867,407	Y363H	probably damaging	Het
Ptprc	A	T	1: 138,067,925	M982K	probably benign	Het
Ptpro	T	A	6: 137,380,266	F252I	probably benign	Het
Pusl1	A	G	4: 155,890,580	V188A	probably benign	Het
Rad54l2	A	G	9: 106,693,222	S1300P	probably benign	Het
Rpl11	G	A	4: 136,051,143		probably benign	Het
Rtel1	T	A	2: 181,355,796	H1104Q	probably damaging	Het
Setbp1	T	C	18: 78,859,922	R177G	probably damaging	Het
Skint6	T	C	4: 113,236,518	T143A	possibly damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Zfp583	A	G	7: 6,317,681	S111P	possibly damaging	Het
Zmiz1	T	C	14: 25,636,010	S140P	probably damaging	Het

Other mutations in Kdm2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Kdm2a	APN	19	4356898	missense	possibly damaging	0.94
IGL00679:Kdm2a	APN	19	4326841	missense	probably damaging	1.00
IGL01104:Kdm2a	APN	19	4356738	splice site	probably benign
IGL01161:Kdm2a	APN	19	4319251	missense	probably benign	0.04
IGL01433:Kdm2a	APN	19	4342860	missense	possibly damaging	0.83
IGL01456:Kdm2a	APN	19	4351755	missense	probably damaging	1.00
IGL01467:Kdm2a	APN	19	4324407	missense	probably damaging	0.99
IGL01517:Kdm2a	APN	19	4362061	splice site	probably benign
IGL01528:Kdm2a	APN	19	4343055	missense	probably benign	0.18
IGL02504:Kdm2a	APN	19	4356771	missense	possibly damaging	0.92
IGL02895:Kdm2a	APN	19	4362902	missense	probably damaging	1.00
IGL03109:Kdm2a	APN	19	4329107	missense	probably benign	0.04
IGL03171:Kdm2a	APN	19	4356764	missense	probably damaging	1.00
IGL03256:Kdm2a	APN	19	4345510	unclassified	probably benign
BB009:Kdm2a	UTSW	19	4319156	missense	probably damaging	0.98
BB019:Kdm2a	UTSW	19	4319156	missense	probably damaging	0.98
P0027:Kdm2a	UTSW	19	4343245	splice site	probably benign
PIT4382001:Kdm2a	UTSW	19	4343173	missense	probably benign
R0220:Kdm2a	UTSW	19	4324919	missense	possibly damaging	0.85
R0961:Kdm2a	UTSW	19	4329191	missense	probably benign	0.07
R1662:Kdm2a	UTSW	19	4328212	missense	probably damaging	1.00
R2023:Kdm2a	UTSW	19	4322464	missense	probably damaging	0.98
R2191:Kdm2a	UTSW	19	4356931	splice site	probably null
R2207:Kdm2a	UTSW	19	4362870	missense	probably damaging	1.00
R2351:Kdm2a	UTSW	19	4329126	missense	probably benign	0.02
R2406:Kdm2a	UTSW	19	4322518	missense	probably damaging	1.00
R2882:Kdm2a	UTSW	19	4331184	critical splice donor site	probably null
R3788:Kdm2a	UTSW	19	4351805	missense	probably damaging	0.99
R3792:Kdm2a	UTSW	19	4324512	missense	possibly damaging	0.91
R3950:Kdm2a	UTSW	19	4343232	missense	possibly damaging	0.89
R4235:Kdm2a	UTSW	19	4322521	missense	probably damaging	0.98
R4466:Kdm2a	UTSW	19	4320300	missense	probably damaging	0.99
R4766:Kdm2a	UTSW	19	4324507	unclassified	probably benign
R4824:Kdm2a	UTSW	19	4362787	missense	probably damaging	1.00
R4838:Kdm2a	UTSW	19	4325026	missense	probably benign	0.41
R5283:Kdm2a	UTSW	19	4331269	missense	probably benign	0.00
R6366:Kdm2a	UTSW	19	4324932	missense	probably benign	0.15
R6368:Kdm2a	UTSW	19	4350317	missense	probably damaging	1.00
R6522:Kdm2a	UTSW	19	4324826	missense	possibly damaging	0.49
R6716:Kdm2a	UTSW	19	4329102	missense	probably damaging	1.00
R6757:Kdm2a	UTSW	19	4319243	missense	probably damaging	0.98
R6912:Kdm2a	UTSW	19	4322501	missense	probably benign	0.06
R6996:Kdm2a	UTSW	19	4345641	missense	probably benign	0.16
R7090:Kdm2a	UTSW	19	4319141	missense	probably damaging	1.00
R7497:Kdm2a	UTSW	19	4324376	missense	probably damaging	1.00
R7542:Kdm2a	UTSW	19	4333830	start gained	probably benign
R7932:Kdm2a	UTSW	19	4319156	missense	probably damaging	0.98
R8199:Kdm2a	UTSW	19	4389026	missense	unknown
R8263:Kdm2a	UTSW	19	4324364	missense	possibly damaging	0.88
R8446:Kdm2a	UTSW	19	4356888	nonsense	probably null
R9158:Kdm2a	UTSW	19	4324687	missense	possibly damaging	0.49
R9303:Kdm2a	UTSW	19	4345578	missense	probably benign	0.01
R9314:Kdm2a	UTSW	19	4322482	missense	probably damaging	1.00
R9351:Kdm2a	UTSW	19	4343113	missense
R9353:Kdm2a	UTSW	19	4343113	missense
R9411:Kdm2a	UTSW	19	4362807	missense	probably damaging	0.99
R9456:Kdm2a	UTSW	19	4343113	missense
R9616:Kdm2a	UTSW	19	4320280	missense	probably damaging	0.99
R9625:Kdm2a	UTSW	19	4343113	missense
RF046:Kdm2a	UTSW	19	4324507	unclassified	probably benign
X0028:Kdm2a	UTSW	19	4320271	missense	possibly damaging	0.77
X0028:Kdm2a	UTSW	19	4348746	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACCCATCTCAGTTAAGTCTCC -3'
(R):5'- AGCAGCTGGATATAGTTGACC -3'

Sequencing Primer
(F):5'- CATCTCAGTTAAGTCTCCCTGAC -3'
(R):5'- CTGGATATAGTTGACCATGCTTTTC -3'

Posted On

2015-07-06