Incidental Mutation 'R4378:Adora1'
ID325176
Institutional Source Beutler Lab
Gene Symbol Adora1
Ensembl Gene ENSMUSG00000042429
Gene Nameadenosine A1 receptor
SynonymsRi, A1AR, A1R, A1-AR, AA1R
MMRRC Submission 041121-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4378 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location134199223-134235431 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134203210 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 241 (F241S)
Ref Sequence ENSEMBL: ENSMUSP00000132105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038191] [ENSMUST00000038445] [ENSMUST00000086465] [ENSMUST00000169927] [ENSMUST00000187631] [ENSMUST00000191577]
Predicted Effect probably damaging
Transcript: ENSMUST00000038191
AA Change: F241S

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043522
Gene: ENSMUSG00000042429
AA Change: F241S

DomainStartEndE-ValueType
Pfam:7tm_4 17 305 1.1e-10 PFAM
Pfam:7TM_GPCR_Srsx 20 303 5e-14 PFAM
Pfam:7tm_1 26 288 9.8e-52 PFAM
low complexity region 311 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038445
SMART Domains Protein: ENSMUSP00000042195
Gene: ENSMUSG00000042451

DomainStartEndE-ValueType
low complexity region 41 66 N/A INTRINSIC
FN3 77 160 4.84e-9 SMART
IG 187 270 9.78e-7 SMART
FN3 273 355 1.1e-7 SMART
IGc2 400 467 1.38e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000086465
AA Change: F241S

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000083656
Gene: ENSMUSG00000042429
AA Change: F241S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 20 303 5e-14 PFAM
Pfam:7tm_1 26 288 1.9e-63 PFAM
low complexity region 311 323 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169927
AA Change: F241S

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132105
Gene: ENSMUSG00000042429
AA Change: F241S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 20 303 5e-14 PFAM
Pfam:7tm_1 26 288 1.9e-63 PFAM
low complexity region 311 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187631
SMART Domains Protein: ENSMUSP00000140801
Gene: ENSMUSG00000042429

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 17 146 1.2e-4 PFAM
Pfam:7TM_GPCR_Srsx 20 148 1.6e-9 PFAM
Pfam:7tm_1 26 176 1.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191577
SMART Domains Protein: ENSMUSP00000141104
Gene: ENSMUSG00000042451

DomainStartEndE-ValueType
low complexity region 41 66 N/A INTRINSIC
FN3 77 160 4.84e-9 SMART
IG 187 270 9.78e-7 SMART
FN3 273 355 1.1e-7 SMART
IGc2 400 467 1.38e-6 SMART
Meta Mutation Damage Score 0.4413 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an adenosine receptor that belongs to the G-protein coupled receptor 1 family. There are 3 types of adenosine receptors, each with a specific pattern of ligand binding and tissue distribution, and together they regulate a diverse set of physiologic functions. The type A1 receptors inhibit adenylyl cyclase, and play a role in the fertilization process. Animal studies also suggest a role for A1 receptors in kidney function and ethanol intoxication. Transcript variants with alternative splicing in the 5' UTR have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele exhibit allodynia, hyperalgesia, increased anxiety, and decreased hypoxic neuroprotection. Homozygotes for a different null allele show increased susceptibility to kidney reperfusion injury and absent tubuloglomerular feedback response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,293,644 K1836E probably benign Het
Akt1s1 C T 7: 44,853,960 T168M probably damaging Het
Amigo1 C T 3: 108,191,753 probably benign Het
Amigo2 A G 15: 97,245,978 F188L possibly damaging Het
Armc2 T C 10: 41,993,082 T29A possibly damaging Het
Axl G A 7: 25,758,837 A822V probably benign Het
Borcs5 T C 6: 134,644,329 V21A probably benign Het
Cdc42ep3 A G 17: 79,334,979 S171P probably benign Het
Cmas T C 6: 142,772,285 probably benign Het
Cyp4f40 A G 17: 32,668,029 N158S probably null Het
Dnah6 G T 6: 73,118,026 N2139K probably benign Het
Elmo1 A T 13: 20,373,116 H409L possibly damaging Het
Exoc4 T A 6: 33,815,687 V584E probably damaging Het
Gm7271 A G 5: 76,500,533 K62R probably damaging Het
Gm9116 A G 3: 93,910,479 noncoding transcript Het
Gxylt2 A G 6: 100,733,200 S101G probably benign Het
Hsph1 C A 5: 149,636,007 E24* probably null Het
Ighv1-56 C T 12: 115,242,948 E50K probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrriq1 A T 10: 103,202,364 D859E probably damaging Het
Mapk7 G A 11: 61,493,667 S71L probably damaging Het
Nars A G 18: 64,501,353 Y500H probably damaging Het
Olfr1165-ps G T 2: 88,101,485 N167K unknown Het
Olfr3 T C 2: 36,812,469 M208V probably benign Het
Phc1 T C 6: 122,335,007 N64S possibly damaging Het
Ppp4r3b T A 11: 29,209,450 N180K possibly damaging Het
Primpol G A 8: 46,576,183 probably benign Het
Prtg T C 9: 72,842,760 S149P possibly damaging Het
Qrich2 T C 11: 116,446,915 S1916G probably damaging Het
Rps6ka5 A T 12: 100,597,937 Y218N probably damaging Het
Setbp1 T C 18: 78,856,618 D1278G possibly damaging Het
Sirt1 C T 10: 63,338,949 A8T probably benign Het
Sobp C T 10: 43,021,304 V762I probably damaging Het
Sptan1 T C 2: 30,025,569 S1994P probably damaging Het
Taok3 T C 5: 117,209,571 I87T probably damaging Het
Tecta T C 9: 42,366,708 Y1168C probably damaging Het
Trhr A G 15: 44,197,627 Y181C probably damaging Het
Ube4b C T 4: 149,383,798 D174N probably damaging Het
Ubr4 C T 4: 139,410,440 H1067Y possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Vmn2r88 T A 14: 51,413,289 L153* probably null Het
Zfp516 T A 18: 82,987,180 D736E probably benign Het
Zfp612 G T 8: 110,089,051 V258F possibly damaging Het
Other mutations in Adora1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Adora1 APN 1 134203213 missense probably damaging 1.00
IGL01641:Adora1 APN 1 134234114 missense probably damaging 1.00
IGL03025:Adora1 APN 1 134203069 missense probably damaging 1.00
R5248:Adora1 UTSW 1 134203486 missense possibly damaging 0.49
R5327:Adora1 UTSW 1 134203010 nonsense probably null
R5408:Adora1 UTSW 1 134203163 missense probably benign 0.02
R6810:Adora1 UTSW 1 134234039 missense probably damaging 1.00
R7844:Adora1 UTSW 1 134203538 missense probably damaging 1.00
R7952:Adora1 UTSW 1 134203286 missense possibly damaging 0.90
R8241:Adora1 UTSW 1 134203324 missense probably damaging 1.00
X0028:Adora1 UTSW 1 134203576 missense probably damaging 0.99
Z1177:Adora1 UTSW 1 134203009 missense probably benign 0.00
Z1177:Adora1 UTSW 1 134234124 missense possibly damaging 0.64
Z1177:Adora1 UTSW 1 134234228 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GTGACCCGGAACTTGTGGATTC -3'
(R):5'- CCCGTGATCAAGTGTGAGTTC -3'

Sequencing Primer
(F):5'- CTTGTGGATTCGGAAGGCATAGAC -3'
(R):5'- GGAGTACATGGTCTACTTCAACTTC -3'
Posted On2015-07-06