Incidental Mutation 'R4378:Olfr3'
ID325178
Institutional Source Beutler Lab
Gene Symbol Olfr3
Ensembl Gene ENSMUSG00000075384
Gene Nameolfactory receptor 3
SynonymsMOR136-14, Y71, GA_x6K02T2NLDC-33507606-33506665
MMRRC Submission 041121-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R4378 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location36811492-36817032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36812469 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 208 (M208V)
Ref Sequence ENSEMBL: ENSMUSP00000149118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100151] [ENSMUST00000213988]
Predicted Effect probably benign
Transcript: ENSMUST00000100151
AA Change: M208V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097728
Gene: ENSMUSG00000075384
AA Change: M208V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.3e-61 PFAM
Pfam:7TM_GPCR_Srsx 35 220 2.9e-7 PFAM
Pfam:7tm_1 41 290 6.3e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120418
Predicted Effect probably benign
Transcript: ENSMUST00000213988
AA Change: M208V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0730 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,293,644 K1836E probably benign Het
Adora1 A G 1: 134,203,210 F241S probably damaging Het
Akt1s1 C T 7: 44,853,960 T168M probably damaging Het
Amigo1 C T 3: 108,191,753 probably benign Het
Amigo2 A G 15: 97,245,978 F188L possibly damaging Het
Armc2 T C 10: 41,993,082 T29A possibly damaging Het
Axl G A 7: 25,758,837 A822V probably benign Het
Borcs5 T C 6: 134,644,329 V21A probably benign Het
Cdc42ep3 A G 17: 79,334,979 S171P probably benign Het
Cmas T C 6: 142,772,285 probably benign Het
Cyp4f40 A G 17: 32,668,029 N158S probably null Het
Dnah6 G T 6: 73,118,026 N2139K probably benign Het
Elmo1 A T 13: 20,373,116 H409L possibly damaging Het
Exoc4 T A 6: 33,815,687 V584E probably damaging Het
Gm7271 A G 5: 76,500,533 K62R probably damaging Het
Gm9116 A G 3: 93,910,479 noncoding transcript Het
Gxylt2 A G 6: 100,733,200 S101G probably benign Het
Hsph1 C A 5: 149,636,007 E24* probably null Het
Ighv1-56 C T 12: 115,242,948 E50K probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrriq1 A T 10: 103,202,364 D859E probably damaging Het
Mapk7 G A 11: 61,493,667 S71L probably damaging Het
Nars A G 18: 64,501,353 Y500H probably damaging Het
Olfr1165-ps G T 2: 88,101,485 N167K unknown Het
Phc1 T C 6: 122,335,007 N64S possibly damaging Het
Ppp4r3b T A 11: 29,209,450 N180K possibly damaging Het
Primpol G A 8: 46,576,183 probably benign Het
Prtg T C 9: 72,842,760 S149P possibly damaging Het
Qrich2 T C 11: 116,446,915 S1916G probably damaging Het
Rps6ka5 A T 12: 100,597,937 Y218N probably damaging Het
Setbp1 T C 18: 78,856,618 D1278G possibly damaging Het
Sirt1 C T 10: 63,338,949 A8T probably benign Het
Sobp C T 10: 43,021,304 V762I probably damaging Het
Sptan1 T C 2: 30,025,569 S1994P probably damaging Het
Taok3 T C 5: 117,209,571 I87T probably damaging Het
Tecta T C 9: 42,366,708 Y1168C probably damaging Het
Trhr A G 15: 44,197,627 Y181C probably damaging Het
Ube4b C T 4: 149,383,798 D174N probably damaging Het
Ubr4 C T 4: 139,410,440 H1067Y possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Vmn2r88 T A 14: 51,413,289 L153* probably null Het
Zfp516 T A 18: 82,987,180 D736E probably benign Het
Zfp612 G T 8: 110,089,051 V258F possibly damaging Het
Other mutations in Olfr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Olfr3 APN 2 36812403 missense probably benign
R0501:Olfr3 UTSW 2 36812480 nonsense probably null
R0519:Olfr3 UTSW 2 36812615 missense probably damaging 1.00
R0890:Olfr3 UTSW 2 36812574 missense probably benign 0.06
R1353:Olfr3 UTSW 2 36812914 missense possibly damaging 0.59
R1543:Olfr3 UTSW 2 36813057 missense probably damaging 1.00
R3435:Olfr3 UTSW 2 36812678 missense probably benign 0.06
R4585:Olfr3 UTSW 2 36812525 missense probably damaging 1.00
R4586:Olfr3 UTSW 2 36812525 missense probably damaging 1.00
R4626:Olfr3 UTSW 2 36812259 missense probably damaging 0.98
R4714:Olfr3 UTSW 2 36813035 missense probably benign 0.37
R4720:Olfr3 UTSW 2 36812472 missense probably benign 0.03
R5390:Olfr3 UTSW 2 36812432 missense probably benign
R5659:Olfr3 UTSW 2 36812954 missense probably damaging 1.00
R5681:Olfr3 UTSW 2 36812681 missense probably benign 0.18
R6750:Olfr3 UTSW 2 36812942 missense possibly damaging 0.90
R7003:Olfr3 UTSW 2 36813035 missense possibly damaging 0.51
R7353:Olfr3 UTSW 2 36812903 missense probably damaging 1.00
R7514:Olfr3 UTSW 2 36812639 missense probably benign 0.03
R8094:Olfr3 UTSW 2 36812318 missense probably damaging 1.00
R8298:Olfr3 UTSW 2 36813026 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGGAGTGACTACTGTGTACATTAC -3'
(R):5'- TCCTGGGTCATAGCTTCTGC -3'

Sequencing Primer
(F):5'- GTGACTACTGTGTACATTACTGAAGC -3'
(R):5'- GCTTCTGCTTGTGCTCTTTTG -3'
Posted On2015-07-06