Incidental Mutation 'R4378:Amigo1'
ID325182
Institutional Source Beutler Lab
Gene Symbol Amigo1
Ensembl Gene ENSMUSG00000050947
Gene Nameadhesion molecule with Ig like domain 1
Synonyms
MMRRC Submission 041121-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4378 (G1)
Quality Score171
Status Validated
Chromosome3
Chromosomal Location108186335-108192286 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) C to T at 108191753 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000050909] [ENSMUST00000065664] [ENSMUST00000106655] [ENSMUST00000106656] [ENSMUST00000106659]
Predicted Effect probably benign
Transcript: ENSMUST00000050909
SMART Domains Protein: ENSMUSP00000061244
Gene: ENSMUSG00000050947

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
LRRNT 33 65 4.45e-2 SMART
LRR_TYP 85 108 3.83e-2 SMART
LRR_TYP 109 132 8.94e-3 SMART
LRR 133 156 2.32e-1 SMART
LRR 157 180 6.57e-1 SMART
LRR 184 207 1.99e0 SMART
LRRCT 221 271 3.59e-3 SMART
IG 275 358 6.65e-9 SMART
low complexity region 380 392 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065664
SMART Domains Protein: ENSMUSP00000070361
Gene: ENSMUSG00000048796

DomainStartEndE-ValueType
B561 1 127 5.49e-40 SMART
transmembrane domain 138 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106655
SMART Domains Protein: ENSMUSP00000102266
Gene: ENSMUSG00000048796

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
B561 54 185 4.96e-47 SMART
transmembrane domain 196 218 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106656
SMART Domains Protein: ENSMUSP00000102267
Gene: ENSMUSG00000050947

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
LRRNT 33 65 4.45e-2 SMART
LRR_TYP 85 108 3.83e-2 SMART
LRR_TYP 109 132 8.94e-3 SMART
LRR 133 156 2.32e-1 SMART
LRR 157 180 6.57e-1 SMART
LRR 184 207 1.99e0 SMART
LRRCT 221 271 3.59e-3 SMART
IG 275 358 6.65e-9 SMART
low complexity region 380 392 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106659
SMART Domains Protein: ENSMUSP00000102270
Gene: ENSMUSG00000050947

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
LRRNT 33 65 4.45e-2 SMART
LRR_TYP 85 108 3.83e-2 SMART
LRR_TYP 109 132 8.94e-3 SMART
LRR 133 156 2.32e-1 SMART
LRR 157 180 6.57e-1 SMART
LRR 184 207 1.99e0 SMART
LRRCT 221 271 3.59e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106661
SMART Domains Protein: ENSMUSP00000102272
Gene: ENSMUSG00000050947

DomainStartEndE-ValueType
low complexity region 2 49 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 141 155 N/A INTRINSIC
LRRNT 167 199 4.45e-2 SMART
LRR_TYP 219 242 3.83e-2 SMART
LRR_TYP 243 266 8.94e-3 SMART
LRR 267 290 2.32e-1 SMART
LRR 291 314 6.57e-1 SMART
LRR 318 341 1.99e0 SMART
LRRCT 355 405 3.59e-3 SMART
IG 409 492 6.65e-9 SMART
low complexity region 514 526 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155099
Predicted Effect probably benign
Transcript: ENSMUST00000155782
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,293,644 K1836E probably benign Het
Adora1 A G 1: 134,203,210 F241S probably damaging Het
Akt1s1 C T 7: 44,853,960 T168M probably damaging Het
Amigo2 A G 15: 97,245,978 F188L possibly damaging Het
Armc2 T C 10: 41,993,082 T29A possibly damaging Het
Axl G A 7: 25,758,837 A822V probably benign Het
Borcs5 T C 6: 134,644,329 V21A probably benign Het
Cdc42ep3 A G 17: 79,334,979 S171P probably benign Het
Cmas T C 6: 142,772,285 probably benign Het
Cyp4f40 A G 17: 32,668,029 N158S probably null Het
Dnah6 G T 6: 73,118,026 N2139K probably benign Het
Elmo1 A T 13: 20,373,116 H409L possibly damaging Het
Exoc4 T A 6: 33,815,687 V584E probably damaging Het
Gm7271 A G 5: 76,500,533 K62R probably damaging Het
Gm9116 A G 3: 93,910,479 noncoding transcript Het
Gxylt2 A G 6: 100,733,200 S101G probably benign Het
Hsph1 C A 5: 149,636,007 E24* probably null Het
Ighv1-56 C T 12: 115,242,948 E50K probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrriq1 A T 10: 103,202,364 D859E probably damaging Het
Mapk7 G A 11: 61,493,667 S71L probably damaging Het
Nars A G 18: 64,501,353 Y500H probably damaging Het
Olfr1165-ps G T 2: 88,101,485 N167K unknown Het
Olfr3 T C 2: 36,812,469 M208V probably benign Het
Phc1 T C 6: 122,335,007 N64S possibly damaging Het
Ppp4r3b T A 11: 29,209,450 N180K possibly damaging Het
Primpol G A 8: 46,576,183 probably benign Het
Prtg T C 9: 72,842,760 S149P possibly damaging Het
Qrich2 T C 11: 116,446,915 S1916G probably damaging Het
Rps6ka5 A T 12: 100,597,937 Y218N probably damaging Het
Setbp1 T C 18: 78,856,618 D1278G possibly damaging Het
Sirt1 C T 10: 63,338,949 A8T probably benign Het
Sobp C T 10: 43,021,304 V762I probably damaging Het
Sptan1 T C 2: 30,025,569 S1994P probably damaging Het
Taok3 T C 5: 117,209,571 I87T probably damaging Het
Tecta T C 9: 42,366,708 Y1168C probably damaging Het
Trhr A G 15: 44,197,627 Y181C probably damaging Het
Ube4b C T 4: 149,383,798 D174N probably damaging Het
Ubr4 C T 4: 139,410,440 H1067Y possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Vmn2r88 T A 14: 51,413,289 L153* probably null Het
Zfp516 T A 18: 82,987,180 D736E probably benign Het
Zfp612 G T 8: 110,089,051 V258F possibly damaging Het
Other mutations in Amigo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02093:Amigo1 APN 3 108187898 missense probably benign
IGL02306:Amigo1 APN 3 108187986 missense probably benign 0.29
R0675:Amigo1 UTSW 3 108191669 splice site probably benign
R0748:Amigo1 UTSW 3 108188630 missense probably damaging 0.98
R1613:Amigo1 UTSW 3 108188220 missense probably benign 0.26
R1991:Amigo1 UTSW 3 108187328 missense probably benign 0.01
R4116:Amigo1 UTSW 3 108188445 missense probably damaging 0.99
R4916:Amigo1 UTSW 3 108187665 missense probably damaging 1.00
R5218:Amigo1 UTSW 3 108187770 splice site probably null
R6074:Amigo1 UTSW 3 108191693 nonsense probably null
R6971:Amigo1 UTSW 3 108188136 missense probably benign 0.11
R7228:Amigo1 UTSW 3 108187230 missense probably benign
R8012:Amigo1 UTSW 3 108188642 missense probably damaging 1.00
R8119:Amigo1 UTSW 3 108187536 missense probably damaging 1.00
R8498:Amigo1 UTSW 3 108188435 missense probably benign 0.01
R8785:Amigo1 UTSW 3 108187350 missense probably benign 0.01
X0025:Amigo1 UTSW 3 108188119 missense probably benign 0.00
X0063:Amigo1 UTSW 3 108188076 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- ATCTATGGGGCCCCTGAAAGAG -3'
(R):5'- TTATAAAACGCTCTGCCTTGGG -3'

Sequencing Primer
(F):5'- GCCCCTGAAAGAGGCCAG -3'
(R):5'- ATAGATGGTGAATCCTCTACGGCC -3'
Posted On2015-07-06