Incidental Mutation 'R4378:Taok3'
ID325188
Institutional Source Beutler Lab
Gene Symbol Taok3
Ensembl Gene ENSMUSG00000061288
Gene NameTAO kinase 3
SynonymsA430105I05Rik, 2900006A08Rik
MMRRC Submission 041121-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4378 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location117120129-117275219 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117209571 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 87 (I87T)
Ref Sequence ENSEMBL: ENSMUSP00000119998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092889] [ENSMUST00000111978] [ENSMUST00000127814] [ENSMUST00000145640] [ENSMUST00000179276]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092889
AA Change: I190T

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000090565
Gene: ENSMUSG00000061288
AA Change: I190T

DomainStartEndE-ValueType
S_TKc 24 277 4.4e-84 SMART
low complexity region 321 337 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
coiled coil region 452 495 N/A INTRINSIC
low complexity region 520 532 N/A INTRINSIC
low complexity region 552 566 N/A INTRINSIC
coiled coil region 618 649 N/A INTRINSIC
coiled coil region 789 869 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111978
AA Change: I190T

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107609
Gene: ENSMUSG00000061288
AA Change: I190T

DomainStartEndE-ValueType
S_TKc 24 277 4.4e-84 SMART
low complexity region 321 337 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
coiled coil region 452 495 N/A INTRINSIC
low complexity region 520 532 N/A INTRINSIC
low complexity region 552 566 N/A INTRINSIC
coiled coil region 618 649 N/A INTRINSIC
coiled coil region 789 869 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126813
Predicted Effect probably damaging
Transcript: ENSMUST00000127814
AA Change: I87T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119998
Gene: ENSMUSG00000061288
AA Change: I87T

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 171 4.8e-27 PFAM
Pfam:Pkinase 2 172 3.1e-42 PFAM
Pfam:Kinase-like 3 133 1.1e-8 PFAM
low complexity region 190 207 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000145640
AA Change: I190T

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000116920
Gene: ENSMUSG00000061288
AA Change: I190T

DomainStartEndE-ValueType
S_TKc 24 277 2.2e-86 SMART
low complexity region 321 337 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
coiled coil region 452 495 N/A INTRINSIC
low complexity region 520 532 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000179276
AA Change: I190T

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000136750
Gene: ENSMUSG00000061288
AA Change: I190T

DomainStartEndE-ValueType
S_TKc 24 277 4.4e-84 SMART
low complexity region 321 337 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
coiled coil region 452 495 N/A INTRINSIC
low complexity region 520 532 N/A INTRINSIC
low complexity region 552 566 N/A INTRINSIC
coiled coil region 618 649 N/A INTRINSIC
coiled coil region 789 869 N/A INTRINSIC
Meta Mutation Damage Score 0.8708 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine protein kinase that activates the p38/MAPK14 stress-activated MAPK cascade but inhibits the basal activity of the MAPK8/JNK cascade. The encoded protein is a member of the GCK subfamily of STE20-like kinases. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,293,644 K1836E probably benign Het
Adora1 A G 1: 134,203,210 F241S probably damaging Het
Akt1s1 C T 7: 44,853,960 T168M probably damaging Het
Amigo1 C T 3: 108,191,753 probably benign Het
Amigo2 A G 15: 97,245,978 F188L possibly damaging Het
Armc2 T C 10: 41,993,082 T29A possibly damaging Het
Axl G A 7: 25,758,837 A822V probably benign Het
Borcs5 T C 6: 134,644,329 V21A probably benign Het
Cdc42ep3 A G 17: 79,334,979 S171P probably benign Het
Cmas T C 6: 142,772,285 probably benign Het
Cyp4f40 A G 17: 32,668,029 N158S probably null Het
Dnah6 G T 6: 73,118,026 N2139K probably benign Het
Elmo1 A T 13: 20,373,116 H409L possibly damaging Het
Exoc4 T A 6: 33,815,687 V584E probably damaging Het
Gm7271 A G 5: 76,500,533 K62R probably damaging Het
Gm9116 A G 3: 93,910,479 noncoding transcript Het
Gxylt2 A G 6: 100,733,200 S101G probably benign Het
Hsph1 C A 5: 149,636,007 E24* probably null Het
Ighv1-56 C T 12: 115,242,948 E50K probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrriq1 A T 10: 103,202,364 D859E probably damaging Het
Mapk7 G A 11: 61,493,667 S71L probably damaging Het
Nars A G 18: 64,501,353 Y500H probably damaging Het
Olfr1165-ps G T 2: 88,101,485 N167K unknown Het
Olfr3 T C 2: 36,812,469 M208V probably benign Het
Phc1 T C 6: 122,335,007 N64S possibly damaging Het
Ppp4r3b T A 11: 29,209,450 N180K possibly damaging Het
Primpol G A 8: 46,576,183 probably benign Het
Prtg T C 9: 72,842,760 S149P possibly damaging Het
Qrich2 T C 11: 116,446,915 S1916G probably damaging Het
Rps6ka5 A T 12: 100,597,937 Y218N probably damaging Het
Setbp1 T C 18: 78,856,618 D1278G possibly damaging Het
Sirt1 C T 10: 63,338,949 A8T probably benign Het
Sobp C T 10: 43,021,304 V762I probably damaging Het
Sptan1 T C 2: 30,025,569 S1994P probably damaging Het
Tecta T C 9: 42,366,708 Y1168C probably damaging Het
Trhr A G 15: 44,197,627 Y181C probably damaging Het
Ube4b C T 4: 149,383,798 D174N probably damaging Het
Ubr4 C T 4: 139,410,440 H1067Y possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Vmn2r88 T A 14: 51,413,289 L153* probably null Het
Zfp516 T A 18: 82,987,180 D736E probably benign Het
Zfp612 G T 8: 110,089,051 V258F possibly damaging Het
Other mutations in Taok3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Taok3 APN 5 117272197 missense probably benign 0.20
IGL01632:Taok3 APN 5 117265928 missense possibly damaging 0.95
IGL02894:Taok3 APN 5 117263613 missense probably benign 0.19
bonze UTSW 5 117272229 nonsense probably null
daoist UTSW 5 117209571 missense probably damaging 0.99
haller UTSW 5 117206655 missense probably damaging 1.00
Perseveration UTSW 5 117255863 missense probably benign 0.25
taoist UTSW 5 117206655 missense probably damaging 1.00
Three_treasures UTSW 5 117217242 critical splice donor site probably null
PIT4366001:Taok3 UTSW 5 117227985 missense probably benign 0.21
R0046:Taok3 UTSW 5 117272229 nonsense probably null
R0046:Taok3 UTSW 5 117272229 nonsense probably null
R0158:Taok3 UTSW 5 117217242 critical splice donor site probably null
R0245:Taok3 UTSW 5 117252679 splice site probably benign
R0371:Taok3 UTSW 5 117206687 nonsense probably null
R1140:Taok3 UTSW 5 117228053 missense possibly damaging 0.94
R1302:Taok3 UTSW 5 117199043 missense possibly damaging 0.46
R1376:Taok3 UTSW 5 117265961 missense probably damaging 1.00
R1376:Taok3 UTSW 5 117265961 missense probably damaging 1.00
R1387:Taok3 UTSW 5 117206655 missense probably damaging 1.00
R1711:Taok3 UTSW 5 117255926 missense possibly damaging 0.68
R1977:Taok3 UTSW 5 117265924 missense probably damaging 0.98
R2898:Taok3 UTSW 5 117200069 critical splice acceptor site probably null
R3824:Taok3 UTSW 5 117255937 missense probably benign 0.01
R4695:Taok3 UTSW 5 117228066 missense probably benign 0.11
R4882:Taok3 UTSW 5 117252630 missense probably damaging 0.99
R5286:Taok3 UTSW 5 117266075 missense probably damaging 1.00
R5522:Taok3 UTSW 5 117273757 missense probably benign 0.00
R5562:Taok3 UTSW 5 117250964 missense probably damaging 1.00
R5643:Taok3 UTSW 5 117206720 missense probably benign
R6241:Taok3 UTSW 5 117272197 missense probably benign 0.33
R6290:Taok3 UTSW 5 117204368 missense probably damaging 1.00
R6310:Taok3 UTSW 5 117255938 missense possibly damaging 0.48
R6339:Taok3 UTSW 5 117228030 missense probably benign
R6717:Taok3 UTSW 5 117240950 intron probably benign
R6721:Taok3 UTSW 5 117255863 missense probably benign 0.25
R6755:Taok3 UTSW 5 117206667 missense probably damaging 1.00
R7046:Taok3 UTSW 5 117273706 missense probably damaging 1.00
R7053:Taok3 UTSW 5 117252562 missense probably benign 0.00
R7259:Taok3 UTSW 5 117252543 missense probably benign 0.00
R7308:Taok3 UTSW 5 117200151 nonsense probably null
R7439:Taok3 UTSW 5 117250909 missense probably damaging 0.99
R7732:Taok3 UTSW 5 117193748 missense possibly damaging 0.53
R7758:Taok3 UTSW 5 117250907 missense probably damaging 1.00
R7939:Taok3 UTSW 5 117193837 missense probably benign 0.01
R8412:Taok3 UTSW 5 117266037 missense possibly damaging 0.59
R8485:Taok3 UTSW 5 117251077 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- ATGTGGCTTCTATGAATAACACCAC -3'
(R):5'- AGTCACAGTCTCCAATACAGGC -3'

Sequencing Primer
(F):5'- GGCTCAGCAGTTAAGTTACTCAC -3'
(R):5'- GCCAACCTACAGCTGTCTG -3'
Posted On2015-07-06