Mutagenetix > Incidental Mutations

Incidental Mutation 'R4378:Gxylt2'

325192

Institutional Source

Beutler Lab

Gene Symbol

Gxylt2

Ensembl Gene

ENSMUSG00000030074

Gene Name

glucoside xylosyltransferase 2

Synonyms

LOC232313, Glt8d4

MMRRC Submission

041121-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4378 (G1)

Quality Score

148

Status

Validated

Chromosome

Chromosomal Location

100704734-100810913 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 100733200 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 101 (S101G)

Ref Sequence

ENSEMBL: ENSMUSP00000032157 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032157]

Predicted Effect

probably benign
Transcript: ENSMUST00000032157
AA Change: S101G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000032157
Gene: ENSMUSG00000030074
AA Change: S101G

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	55	89	N/A	INTRINSIC
Pfam:Glyco_transf_8	112	364	1.5e-15	PFAM

Meta Mutation Damage Score

0.0984

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a xylosyltransferase that elongates O-linked glucose bound to epidermal growth factor (EGF) repeats. The encoded protein catalyzes the addition of xylose to the O-glucose-modified residues of EGF repeats of Notch proteins. [provided by RefSeq, Sep 2016]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	G	11: 9,293,644	K1836E	probably benign	Het
Adora1	A	G	1: 134,203,210	F241S	probably damaging	Het
Akt1s1	C	T	7: 44,853,960	T168M	probably damaging	Het
Amigo1	C	T	3: 108,191,753		probably benign	Het
Amigo2	A	G	15: 97,245,978	F188L	possibly damaging	Het
Armc2	T	C	10: 41,993,082	T29A	possibly damaging	Het
Axl	G	A	7: 25,758,837	A822V	probably benign	Het
Borcs5	T	C	6: 134,644,329	V21A	probably benign	Het
Cdc42ep3	A	G	17: 79,334,979	S171P	probably benign	Het
Cmas	T	C	6: 142,772,285		probably benign	Het
Cyp4f40	A	G	17: 32,668,029	N158S	probably null	Het
Dnah6	G	T	6: 73,118,026	N2139K	probably benign	Het
Elmo1	A	T	13: 20,373,116	H409L	possibly damaging	Het
Exoc4	T	A	6: 33,815,687	V584E	probably damaging	Het
Gm7271	A	G	5: 76,500,533	K62R	probably damaging	Het
Gm9116	A	G	3: 93,910,479		noncoding transcript	Het
Hsph1	C	A	5: 149,636,007	E24*	probably null	Het
Ighv1-56	C	T	12: 115,242,948	E50K	probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lrriq1	A	T	10: 103,202,364	D859E	probably damaging	Het
Mapk7	G	A	11: 61,493,667	S71L	probably damaging	Het
Nars	A	G	18: 64,501,353	Y500H	probably damaging	Het
Olfr1165-ps	G	T	2: 88,101,485	N167K	unknown	Het
Olfr3	T	C	2: 36,812,469	M208V	probably benign	Het
Phc1	T	C	6: 122,335,007	N64S	possibly damaging	Het
Ppp4r3b	T	A	11: 29,209,450	N180K	possibly damaging	Het
Primpol	G	A	8: 46,576,183		probably benign	Het
Prtg	T	C	9: 72,842,760	S149P	possibly damaging	Het
Qrich2	T	C	11: 116,446,915	S1916G	probably damaging	Het
Rps6ka5	A	T	12: 100,597,937	Y218N	probably damaging	Het
Setbp1	T	C	18: 78,856,618	D1278G	possibly damaging	Het
Sirt1	C	T	10: 63,338,949	A8T	probably benign	Het
Sobp	C	T	10: 43,021,304	V762I	probably damaging	Het
Sptan1	T	C	2: 30,025,569	S1994P	probably damaging	Het
Taok3	T	C	5: 117,209,571	I87T	probably damaging	Het
Tecta	T	C	9: 42,366,708	Y1168C	probably damaging	Het
Trhr	A	G	15: 44,197,627	Y181C	probably damaging	Het
Ube4b	C	T	4: 149,383,798	D174N	probably damaging	Het
Ubr4	C	T	4: 139,410,440	H1067Y	possibly damaging	Het
Vmn2r86	A	G	10: 130,452,600	I344T	possibly damaging	Het
Vmn2r88	T	A	14: 51,413,289	L153*	probably null	Het
Zfp516	T	A	18: 82,987,180	D736E	probably benign	Het
Zfp612	G	T	8: 110,089,051	V258F	possibly damaging	Het

Other mutations in Gxylt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01290:Gxylt2	APN	6	100750447	missense	probably damaging	1.00
IGL01533:Gxylt2	APN	6	100783137	missense	probably damaging	1.00
R0047:Gxylt2	UTSW	6	100733378	splice site	probably benign
R0047:Gxylt2	UTSW	6	100733378	splice site	probably benign
R0328:Gxylt2	UTSW	6	100750535	splice site	probably benign
R1159:Gxylt2	UTSW	6	100804641	missense	possibly damaging	0.82
R2173:Gxylt2	UTSW	6	100798154	missense	probably damaging	1.00
R2307:Gxylt2	UTSW	6	100787212	missense	probably damaging	1.00
R4112:Gxylt2	UTSW	6	100783206	missense	probably damaging	1.00
R5032:Gxylt2	UTSW	6	100783181	missense	probably benign	0.22
R5206:Gxylt2	UTSW	6	100804615	missense	probably damaging	0.98
R5305:Gxylt2	UTSW	6	100787218	missense	probably damaging	0.98
R5394:Gxylt2	UTSW	6	100705114	missense	probably benign	0.01
R5497:Gxylt2	UTSW	6	100787329	missense	probably benign	0.10
R5814:Gxylt2	UTSW	6	100733235	missense	probably damaging	1.00
R5864:Gxylt2	UTSW	6	100783146	missense	probably damaging	1.00
R6038:Gxylt2	UTSW	6	100804594	missense	probably damaging	1.00
R6038:Gxylt2	UTSW	6	100804594	missense	probably damaging	1.00
R6314:Gxylt2	UTSW	6	100798203	missense	probably damaging	1.00
R7051:Gxylt2	UTSW	6	100804576	nonsense	probably null
R7375:Gxylt2	UTSW	6	100750422	missense	probably benign	0.28
R7607:Gxylt2	UTSW	6	100798190	missense	possibly damaging	0.95
R7617:Gxylt2	UTSW	6	100783185	missense	probably damaging	1.00
R7658:Gxylt2	UTSW	6	100783143	missense	probably damaging	1.00
R7685:Gxylt2	UTSW	6	100804528	missense	probably benign	0.01
R7744:Gxylt2	UTSW	6	100783317	missense	probably damaging	0.99
R7980:Gxylt2	UTSW	6	100787209	critical splice acceptor site	probably null
R8093:Gxylt2	UTSW	6	100733227	missense	probably damaging	1.00
Z1176:Gxylt2	UTSW	6	100783191	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGGTGACTCATCTCATTATGGC -3'
(R):5'- CGTCACCTGTTTATCAAACTCGG -3'

Sequencing Primer
(F):5'- ATGGTGTTTTTCTACAAGCAGGAAG -3'
(R):5'- GTTTATCAAACTCGGGCTTCAGAGC -3'

Posted On

2015-07-06