Incidental Mutation 'R4378:Axl'
ID325195
Institutional Source Beutler Lab
Gene Symbol Axl
Ensembl Gene ENSMUSG00000002602
Gene NameAXL receptor tyrosine kinase
SynonymsTyro7, Ufo, Ark
MMRRC Submission 041121-MU
Accession Numbers

Genbank: NM_009465; MGI: 1347244

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4378 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location25757273-25788705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25758837 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 822 (A822V)
Ref Sequence ENSEMBL: ENSMUSP00000083110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002677] [ENSMUST00000043765] [ENSMUST00000085948] [ENSMUST00000108401] [ENSMUST00000206832]
Predicted Effect probably benign
Transcript: ENSMUST00000002677
AA Change: A831V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002677
Gene: ENSMUSG00000002602
AA Change: A831V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 35 124 5.53e-6 SMART
IG 139 218 9.06e-2 SMART
FN3 219 312 9.25e-6 SMART
FN3 328 409 2.18e-2 SMART
transmembrane domain 444 466 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
TyrKc 530 797 1.91e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043765
SMART Domains Protein: ENSMUSP00000037268
Gene: ENSMUSG00000040725

DomainStartEndE-ValueType
SAP 3 37 2.86e-10 SMART
low complexity region 62 74 N/A INTRINSIC
low complexity region 78 91 N/A INTRINSIC
low complexity region 201 209 N/A INTRINSIC
SPRY 255 388 8.49e-41 SMART
Pfam:AAA_33 424 569 1.4e-29 PFAM
low complexity region 613 626 N/A INTRINSIC
low complexity region 631 693 N/A INTRINSIC
low complexity region 695 718 N/A INTRINSIC
low complexity region 745 765 N/A INTRINSIC
low complexity region 768 859 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085948
AA Change: A822V

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000083110
Gene: ENSMUSG00000002602
AA Change: A822V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 35 124 5.53e-6 SMART
IG 139 218 9.06e-2 SMART
FN3 219 312 9.25e-6 SMART
FN3 328 409 2.18e-2 SMART
transmembrane domain 435 457 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
TyrKc 521 788 1.91e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108401
SMART Domains Protein: ENSMUSP00000104038
Gene: ENSMUSG00000040725

DomainStartEndE-ValueType
SAP 3 37 2.86e-10 SMART
low complexity region 62 74 N/A INTRINSIC
low complexity region 78 91 N/A INTRINSIC
low complexity region 201 209 N/A INTRINSIC
Pfam:SPRY 255 338 2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132989
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137211
Predicted Effect probably benign
Transcript: ENSMUST00000206832
Meta Mutation Damage Score 0.0875 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Tyro3-Axl-Mer (TAM) receptor tyrosine kinase subfamily. The encoded protein possesses an extracellular domain which is composed of two immunoglobulin-like motifs at the N-terminal, followed by two fibronectin type-III motifs. It transduces signals from the extracellular matrix into the cytoplasm by binding to the vitamin K-dependent protein growth arrest-specific 6 (Gas6). This gene may be involved in several cellular functions including growth, migration, aggregation and anti-inflammation in multiple cell types. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutant mice are phenotypically normal, however in conjunction with mutations in other related receptor tyrosine kinases, mutations of this gene results in fertility defects, autoimmunity abnormalities, and aberrant apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,293,644 K1836E probably benign Het
Adora1 A G 1: 134,203,210 F241S probably damaging Het
Akt1s1 C T 7: 44,853,960 T168M probably damaging Het
Amigo1 C T 3: 108,191,753 probably benign Het
Amigo2 A G 15: 97,245,978 F188L possibly damaging Het
Armc2 T C 10: 41,993,082 T29A possibly damaging Het
Borcs5 T C 6: 134,644,329 V21A probably benign Het
Cdc42ep3 A G 17: 79,334,979 S171P probably benign Het
Cmas T C 6: 142,772,285 probably benign Het
Cyp4f40 A G 17: 32,668,029 N158S probably null Het
Dnah6 G T 6: 73,118,026 N2139K probably benign Het
Elmo1 A T 13: 20,373,116 H409L possibly damaging Het
Exoc4 T A 6: 33,815,687 V584E probably damaging Het
Gm7271 A G 5: 76,500,533 K62R probably damaging Het
Gm9116 A G 3: 93,910,479 noncoding transcript Het
Gxylt2 A G 6: 100,733,200 S101G probably benign Het
Hsph1 C A 5: 149,636,007 E24* probably null Het
Ighv1-56 C T 12: 115,242,948 E50K probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrriq1 A T 10: 103,202,364 D859E probably damaging Het
Mapk7 G A 11: 61,493,667 S71L probably damaging Het
Nars A G 18: 64,501,353 Y500H probably damaging Het
Olfr1165-ps G T 2: 88,101,485 N167K unknown Het
Olfr3 T C 2: 36,812,469 M208V probably benign Het
Phc1 T C 6: 122,335,007 N64S possibly damaging Het
Ppp4r3b T A 11: 29,209,450 N180K possibly damaging Het
Primpol G A 8: 46,576,183 probably benign Het
Prtg T C 9: 72,842,760 S149P possibly damaging Het
Qrich2 T C 11: 116,446,915 S1916G probably damaging Het
Rps6ka5 A T 12: 100,597,937 Y218N probably damaging Het
Setbp1 T C 18: 78,856,618 D1278G possibly damaging Het
Sirt1 C T 10: 63,338,949 A8T probably benign Het
Sobp C T 10: 43,021,304 V762I probably damaging Het
Sptan1 T C 2: 30,025,569 S1994P probably damaging Het
Taok3 T C 5: 117,209,571 I87T probably damaging Het
Tecta T C 9: 42,366,708 Y1168C probably damaging Het
Trhr A G 15: 44,197,627 Y181C probably damaging Het
Ube4b C T 4: 149,383,798 D174N probably damaging Het
Ubr4 C T 4: 139,410,440 H1067Y possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Vmn2r88 T A 14: 51,413,289 L153* probably null Het
Zfp516 T A 18: 82,987,180 D736E probably benign Het
Zfp612 G T 8: 110,089,051 V258F possibly damaging Het
Other mutations in Axl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Axl APN 7 25785899 missense probably benign 0.16
IGL00428:Axl APN 7 25760872 missense probably damaging 1.00
IGL00725:Axl APN 7 25764483 missense probably damaging 0.97
IGL01348:Axl APN 7 25763309 missense probably damaging 1.00
IGL01350:Axl APN 7 25758750 missense probably damaging 1.00
IGL01357:Axl APN 7 25774169 missense probably benign 0.00
IGL02314:Axl APN 7 25786920 missense possibly damaging 0.50
IGL02321:Axl APN 7 25758769 missense probably damaging 1.00
IGL02839:Axl APN 7 25766791 critical splice donor site probably null
IGL02878:Axl APN 7 25758877 missense probably damaging 0.99
R0125:Axl UTSW 7 25786943 missense probably benign 0.00
R0529:Axl UTSW 7 25787287 splice site probably benign
R0539:Axl UTSW 7 25778717 unclassified probably benign
R0614:Axl UTSW 7 25774163 missense probably benign 0.18
R0747:Axl UTSW 7 25764059 missense possibly damaging 0.95
R1599:Axl UTSW 7 25763969 missense probably damaging 0.99
R1727:Axl UTSW 7 25760766 missense possibly damaging 0.68
R1880:Axl UTSW 7 25774548 missense probably damaging 1.00
R2206:Axl UTSW 7 25770636 missense probably damaging 1.00
R2513:Axl UTSW 7 25787516 missense probably benign
R2877:Axl UTSW 7 25766524 missense probably damaging 0.96
R3802:Axl UTSW 7 25788477 start codon destroyed probably null 0.98
R3915:Axl UTSW 7 25760744 splice site probably benign
R4064:Axl UTSW 7 25764020 missense probably benign 0.36
R4072:Axl UTSW 7 25763911 unclassified probably benign
R4073:Axl UTSW 7 25763911 unclassified probably benign
R4074:Axl UTSW 7 25763911 unclassified probably benign
R5039:Axl UTSW 7 25785915 missense probably damaging 1.00
R5224:Axl UTSW 7 25786944 missense probably benign 0.00
R5328:Axl UTSW 7 25773411 missense probably damaging 1.00
R5519:Axl UTSW 7 25778662 missense possibly damaging 0.93
R5885:Axl UTSW 7 25766852 missense probably damaging 1.00
R6367:Axl UTSW 7 25787433 missense probably damaging 1.00
R6447:Axl UTSW 7 25770283 missense probably damaging 0.96
R6931:Axl UTSW 7 25761433 missense probably damaging 1.00
R7172:Axl UTSW 7 25786974 missense probably benign 0.33
R7355:Axl UTSW 7 25774106 missense probably benign 0.22
R7410:Axl UTSW 7 25758783 missense probably benign 0.06
R8274:Axl UTSW 7 25764013 missense probably damaging 0.99
R8279:Axl UTSW 7 25763954 missense probably benign 0.07
R8281:Axl UTSW 7 25763954 missense probably benign 0.07
R8282:Axl UTSW 7 25763954 missense probably benign 0.07
R8283:Axl UTSW 7 25763954 missense probably benign 0.07
R8546:Axl UTSW 7 25774163 missense probably benign 0.00
R8742:Axl UTSW 7 25764436 missense probably damaging 0.99
X0027:Axl UTSW 7 25770268 missense probably damaging 1.00
Z1177:Axl UTSW 7 25761526 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATTGTCTCAGGCTCCGTC -3'
(R):5'- TCTAGCATGCTACCCTCTGAGC -3'

Sequencing Primer
(F):5'- AGGCTCCGTCCTCCTGC -3'
(R):5'- ATTAGGTATGCCCTGATGTCTC -3'
Posted On2015-07-06