Incidental Mutation 'R4378:Primpol'
ID325196
Institutional Source Beutler Lab
Gene Symbol Primpol
Ensembl Gene ENSMUSG00000038225
Gene Nameprimase and polymerase (DNA-directed)
SynonymsCcdc111
MMRRC Submission 041121-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4378 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location46575594-46617212 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) G to A at 46576183 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034045] [ENSMUST00000040468] [ENSMUST00000093518] [ENSMUST00000135432] [ENSMUST00000136335] [ENSMUST00000209787] [ENSMUST00000211400]
Predicted Effect probably benign
Transcript: ENSMUST00000034045
SMART Domains Protein: ENSMUSP00000034045
Gene: ENSMUSG00000031629

DomainStartEndE-ValueType
low complexity region 58 66 N/A INTRINSIC
Pfam:CENP-U 138 312 6.5e-74 PFAM
low complexity region 340 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040468
SMART Domains Protein: ENSMUSP00000036119
Gene: ENSMUSG00000038225

DomainStartEndE-ValueType
Pfam:Herpes_UL52 384 448 1.3e-19 PFAM
low complexity region 465 478 N/A INTRINSIC
low complexity region 491 516 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093518
SMART Domains Protein: ENSMUSP00000091239
Gene: ENSMUSG00000031629

DomainStartEndE-ValueType
Pfam:CENP-U 39 162 4.6e-61 PFAM
low complexity region 190 204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122838
Predicted Effect probably benign
Transcript: ENSMUST00000135432
Predicted Effect probably benign
Transcript: ENSMUST00000136335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136724
Predicted Effect probably benign
Transcript: ENSMUST00000209787
Predicted Effect probably benign
Transcript: ENSMUST00000211400
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA primase-polymerase that belongs to a superfamily of archaeao-eukaryotic primases. Members of this family have primase activity, catalyzing the synthesis of short RNA primers that serve as starting points for DNA synthesis, as well as DNA polymerase activity. The encoded protein facilitates DNA damage tolerance by mediating uninterrupted fork progression after UV irradiation and reinitiating DNA synthesis. An allelic variant in this gene is associated with myopia 22. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous null mutants are viable and fertile. Mice homozygous for another knock-out allele exhibit selective increase in C to G transversions in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,293,644 K1836E probably benign Het
Adora1 A G 1: 134,203,210 F241S probably damaging Het
Akt1s1 C T 7: 44,853,960 T168M probably damaging Het
Amigo1 C T 3: 108,191,753 probably benign Het
Amigo2 A G 15: 97,245,978 F188L possibly damaging Het
Armc2 T C 10: 41,993,082 T29A possibly damaging Het
Axl G A 7: 25,758,837 A822V probably benign Het
Borcs5 T C 6: 134,644,329 V21A probably benign Het
Cdc42ep3 A G 17: 79,334,979 S171P probably benign Het
Cmas T C 6: 142,772,285 probably benign Het
Cyp4f40 A G 17: 32,668,029 N158S probably null Het
Dnah6 G T 6: 73,118,026 N2139K probably benign Het
Elmo1 A T 13: 20,373,116 H409L possibly damaging Het
Exoc4 T A 6: 33,815,687 V584E probably damaging Het
Gm7271 A G 5: 76,500,533 K62R probably damaging Het
Gm9116 A G 3: 93,910,479 noncoding transcript Het
Gxylt2 A G 6: 100,733,200 S101G probably benign Het
Hsph1 C A 5: 149,636,007 E24* probably null Het
Ighv1-56 C T 12: 115,242,948 E50K probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrriq1 A T 10: 103,202,364 D859E probably damaging Het
Mapk7 G A 11: 61,493,667 S71L probably damaging Het
Nars A G 18: 64,501,353 Y500H probably damaging Het
Olfr1165-ps G T 2: 88,101,485 N167K unknown Het
Olfr3 T C 2: 36,812,469 M208V probably benign Het
Phc1 T C 6: 122,335,007 N64S possibly damaging Het
Ppp4r3b T A 11: 29,209,450 N180K possibly damaging Het
Prtg T C 9: 72,842,760 S149P possibly damaging Het
Qrich2 T C 11: 116,446,915 S1916G probably damaging Het
Rps6ka5 A T 12: 100,597,937 Y218N probably damaging Het
Setbp1 T C 18: 78,856,618 D1278G possibly damaging Het
Sirt1 C T 10: 63,338,949 A8T probably benign Het
Sobp C T 10: 43,021,304 V762I probably damaging Het
Sptan1 T C 2: 30,025,569 S1994P probably damaging Het
Taok3 T C 5: 117,209,571 I87T probably damaging Het
Tecta T C 9: 42,366,708 Y1168C probably damaging Het
Trhr A G 15: 44,197,627 Y181C probably damaging Het
Ube4b C T 4: 149,383,798 D174N probably damaging Het
Ubr4 C T 4: 139,410,440 H1067Y possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Vmn2r88 T A 14: 51,413,289 L153* probably null Het
Zfp516 T A 18: 82,987,180 D736E probably benign Het
Zfp612 G T 8: 110,089,051 V258F possibly damaging Het
Other mutations in Primpol
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Primpol APN 8 46581597 missense probably damaging 0.98
IGL02421:Primpol APN 8 46607795 splice site probably benign
IGL02886:Primpol APN 8 46593584 nonsense probably null
IGL03244:Primpol APN 8 46586440 missense probably damaging 1.00
R0243:Primpol UTSW 8 46599814 missense probably damaging 1.00
R0329:Primpol UTSW 8 46610461 missense probably damaging 0.97
R0330:Primpol UTSW 8 46610461 missense probably damaging 0.97
R0571:Primpol UTSW 8 46581639 missense probably damaging 1.00
R1266:Primpol UTSW 8 46593699 missense probably damaging 1.00
R1334:Primpol UTSW 8 46586391 missense probably damaging 1.00
R1469:Primpol UTSW 8 46593637 missense probably benign
R1469:Primpol UTSW 8 46593637 missense probably benign
R1524:Primpol UTSW 8 46586467 intron probably benign
R1738:Primpol UTSW 8 46607838 missense probably damaging 0.98
R2144:Primpol UTSW 8 46586343 missense probably damaging 0.99
R3747:Primpol UTSW 8 46599813 missense probably benign 0.34
R3748:Primpol UTSW 8 46599813 missense probably benign 0.34
R3750:Primpol UTSW 8 46599813 missense probably benign 0.34
R4855:Primpol UTSW 8 46586691 missense probably benign 0.00
R5209:Primpol UTSW 8 46590260 missense probably benign 0.00
R5497:Primpol UTSW 8 46592622 nonsense probably null
R5720:Primpol UTSW 8 46581642 missense probably damaging 1.00
R5963:Primpol UTSW 8 46593580 missense possibly damaging 0.93
R6164:Primpol UTSW 8 46586442 missense probably benign 0.10
R6497:Primpol UTSW 8 46586341 critical splice donor site probably null
R6549:Primpol UTSW 8 46605150 missense probably damaging 1.00
R7595:Primpol UTSW 8 46610615 missense probably benign 0.00
R7775:Primpol UTSW 8 46586424 missense probably damaging 1.00
R7778:Primpol UTSW 8 46586424 missense probably damaging 1.00
R7824:Primpol UTSW 8 46586424 missense probably damaging 1.00
R8055:Primpol UTSW 8 46579162 missense probably benign 0.34
R8840:Primpol UTSW 8 46593696 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTTCATAGTGTGCGAGG -3'
(R):5'- TGCAGTAACCAGGACTCACC -3'

Sequencing Primer
(F):5'- GGCCACCAAGTCCACTTCTG -3'
(R):5'- GGTCCTTTCTCTTGAACGTTTG -3'
Posted On2015-07-06