Incidental Mutation 'R4378:Zfp612'
ID325197
Institutional Source Beutler Lab
Gene Symbol Zfp612
Ensembl Gene ENSMUSG00000044676
Gene Namezinc finger protein 612
Synonyms
MMRRC Submission 041121-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4378 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location110079746-110092741 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 110089051 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 258 (V258F)
Ref Sequence ENSEMBL: ENSMUSP00000062474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058804] [ENSMUST00000165700] [ENSMUST00000212754]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058804
AA Change: V258F

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000062474
Gene: ENSMUSG00000044676
AA Change: V258F

DomainStartEndE-ValueType
KRAB 11 71 2e-32 SMART
low complexity region 135 146 N/A INTRINSIC
ZnF_C2H2 225 247 1.45e-2 SMART
ZnF_C2H2 253 275 2.67e-1 SMART
ZnF_C2H2 281 303 1.4e-4 SMART
ZnF_C2H2 309 331 2.91e-2 SMART
ZnF_C2H2 337 359 3.16e-3 SMART
ZnF_C2H2 365 387 4.17e-3 SMART
ZnF_C2H2 393 415 1.82e-3 SMART
ZnF_C2H2 421 443 3.69e-4 SMART
ZnF_C2H2 449 471 3.69e-4 SMART
ZnF_C2H2 477 499 1.58e-3 SMART
ZnF_C2H2 505 527 4.87e-4 SMART
ZnF_C2H2 533 555 1.38e-3 SMART
ZnF_C2H2 561 583 5.06e-2 SMART
ZnF_C2H2 589 611 5.9e-3 SMART
ZnF_C2H2 617 639 9.44e-2 SMART
ZnF_C2H2 645 667 1.03e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165700
Predicted Effect possibly damaging
Transcript: ENSMUST00000212754
AA Change: V297F

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,293,644 K1836E probably benign Het
Adora1 A G 1: 134,203,210 F241S probably damaging Het
Akt1s1 C T 7: 44,853,960 T168M probably damaging Het
Amigo1 C T 3: 108,191,753 probably benign Het
Amigo2 A G 15: 97,245,978 F188L possibly damaging Het
Armc2 T C 10: 41,993,082 T29A possibly damaging Het
Axl G A 7: 25,758,837 A822V probably benign Het
Borcs5 T C 6: 134,644,329 V21A probably benign Het
Cdc42ep3 A G 17: 79,334,979 S171P probably benign Het
Cmas T C 6: 142,772,285 probably benign Het
Cyp4f40 A G 17: 32,668,029 N158S probably null Het
Dnah6 G T 6: 73,118,026 N2139K probably benign Het
Elmo1 A T 13: 20,373,116 H409L possibly damaging Het
Exoc4 T A 6: 33,815,687 V584E probably damaging Het
Gm7271 A G 5: 76,500,533 K62R probably damaging Het
Gm9116 A G 3: 93,910,479 noncoding transcript Het
Gxylt2 A G 6: 100,733,200 S101G probably benign Het
Hsph1 C A 5: 149,636,007 E24* probably null Het
Ighv1-56 C T 12: 115,242,948 E50K probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrriq1 A T 10: 103,202,364 D859E probably damaging Het
Mapk7 G A 11: 61,493,667 S71L probably damaging Het
Nars A G 18: 64,501,353 Y500H probably damaging Het
Olfr1165-ps G T 2: 88,101,485 N167K unknown Het
Olfr3 T C 2: 36,812,469 M208V probably benign Het
Phc1 T C 6: 122,335,007 N64S possibly damaging Het
Ppp4r3b T A 11: 29,209,450 N180K possibly damaging Het
Primpol G A 8: 46,576,183 probably benign Het
Prtg T C 9: 72,842,760 S149P possibly damaging Het
Qrich2 T C 11: 116,446,915 S1916G probably damaging Het
Rps6ka5 A T 12: 100,597,937 Y218N probably damaging Het
Setbp1 T C 18: 78,856,618 D1278G possibly damaging Het
Sirt1 C T 10: 63,338,949 A8T probably benign Het
Sobp C T 10: 43,021,304 V762I probably damaging Het
Sptan1 T C 2: 30,025,569 S1994P probably damaging Het
Taok3 T C 5: 117,209,571 I87T probably damaging Het
Tecta T C 9: 42,366,708 Y1168C probably damaging Het
Trhr A G 15: 44,197,627 Y181C probably damaging Het
Ube4b C T 4: 149,383,798 D174N probably damaging Het
Ubr4 C T 4: 139,410,440 H1067Y possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Vmn2r88 T A 14: 51,413,289 L153* probably null Het
Zfp516 T A 18: 82,987,180 D736E probably benign Het
Other mutations in Zfp612
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8562:Zfp612 UTSW 8 110090038 missense probably damaging 1.00
R1920:Zfp612 UTSW 8 110088463 missense probably benign 0.03
R2994:Zfp612 UTSW 8 110089417 missense probably damaging 1.00
R4281:Zfp612 UTSW 8 110090059 missense probably damaging 0.98
R4492:Zfp612 UTSW 8 110089297 missense probably damaging 0.99
R4748:Zfp612 UTSW 8 110088672 missense probably benign 0.37
R4890:Zfp612 UTSW 8 110089944 nonsense probably null
R5200:Zfp612 UTSW 8 110089900 nonsense probably null
R5443:Zfp612 UTSW 8 110089595 missense possibly damaging 0.85
R5864:Zfp612 UTSW 8 110089726 missense probably damaging 1.00
R6177:Zfp612 UTSW 8 110089974 missense probably damaging 1.00
R6435:Zfp612 UTSW 8 110089320 missense probably damaging 0.99
R6601:Zfp612 UTSW 8 110089549 missense possibly damaging 0.92
R7082:Zfp612 UTSW 8 110089705 missense probably damaging 1.00
R7083:Zfp612 UTSW 8 110089136 missense probably damaging 1.00
R8837:Zfp612 UTSW 8 110088971 missense probably damaging 1.00
RF007:Zfp612 UTSW 8 110089542 nonsense probably null
RF008:Zfp612 UTSW 8 110089561 missense probably damaging 1.00
Z1176:Zfp612 UTSW 8 110088863 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTCCAGAGATCTGTGATG -3'
(R):5'- GATGCTGAATCAGTTTTGCGTTAAC -3'

Sequencing Primer
(F):5'- TAAAGCCAAGTTCGTCTGGC -3'
(R):5'- CGTTAACATTGAAGGCTTTCCCACAG -3'
Posted On2015-07-06