Incidental Mutation 'R4378:Sobp'
ID325201
Institutional Source Beutler Lab
Gene Symbol Sobp
Ensembl Gene ENSMUSG00000038248
Gene Namesine oculis binding protein
Synonyms2900009C16Rik, jc, 5330439J01Rik, Jxc1
MMRRC Submission 041121-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.748) question?
Stock #R4378 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location43002500-43174530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43021304 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 762 (V762I)
Ref Sequence ENSEMBL: ENSMUSP00000040072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040275]
Predicted Effect probably damaging
Transcript: ENSMUST00000040275
AA Change: V762I

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040072
Gene: ENSMUSG00000038248
AA Change: V762I

DomainStartEndE-ValueType
low complexity region 125 139 N/A INTRINSIC
internal_repeat_1 149 201 2.34e-5 PROSPERO
Pfam:SOBP 224 543 1.5e-88 PFAM
low complexity region 565 583 N/A INTRINSIC
low complexity region 590 603 N/A INTRINSIC
low complexity region 625 639 N/A INTRINSIC
low complexity region 695 714 N/A INTRINSIC
low complexity region 725 747 N/A INTRINSIC
Meta Mutation Damage Score 0.0680 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear zinc finger protein that is involved in development of the cochlea. Defects in this gene have also been linked to intellectual disability. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous mutant mice exhibit open-field hyperactivity and circling behavior from weaning. Their hearing thresholds are elevated at all frequencies; the hearing impairment does not progress over time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,293,644 K1836E probably benign Het
Adora1 A G 1: 134,203,210 F241S probably damaging Het
Akt1s1 C T 7: 44,853,960 T168M probably damaging Het
Amigo1 C T 3: 108,191,753 probably benign Het
Amigo2 A G 15: 97,245,978 F188L possibly damaging Het
Armc2 T C 10: 41,993,082 T29A possibly damaging Het
Axl G A 7: 25,758,837 A822V probably benign Het
Borcs5 T C 6: 134,644,329 V21A probably benign Het
Cdc42ep3 A G 17: 79,334,979 S171P probably benign Het
Cmas T C 6: 142,772,285 probably benign Het
Cyp4f40 A G 17: 32,668,029 N158S probably null Het
Dnah6 G T 6: 73,118,026 N2139K probably benign Het
Elmo1 A T 13: 20,373,116 H409L possibly damaging Het
Exoc4 T A 6: 33,815,687 V584E probably damaging Het
Gm7271 A G 5: 76,500,533 K62R probably damaging Het
Gm9116 A G 3: 93,910,479 noncoding transcript Het
Gxylt2 A G 6: 100,733,200 S101G probably benign Het
Hsph1 C A 5: 149,636,007 E24* probably null Het
Ighv1-56 C T 12: 115,242,948 E50K probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrriq1 A T 10: 103,202,364 D859E probably damaging Het
Mapk7 G A 11: 61,493,667 S71L probably damaging Het
Nars A G 18: 64,501,353 Y500H probably damaging Het
Olfr1165-ps G T 2: 88,101,485 N167K unknown Het
Olfr3 T C 2: 36,812,469 M208V probably benign Het
Phc1 T C 6: 122,335,007 N64S possibly damaging Het
Ppp4r3b T A 11: 29,209,450 N180K possibly damaging Het
Primpol G A 8: 46,576,183 probably benign Het
Prtg T C 9: 72,842,760 S149P possibly damaging Het
Qrich2 T C 11: 116,446,915 S1916G probably damaging Het
Rps6ka5 A T 12: 100,597,937 Y218N probably damaging Het
Setbp1 T C 18: 78,856,618 D1278G possibly damaging Het
Sirt1 C T 10: 63,338,949 A8T probably benign Het
Sptan1 T C 2: 30,025,569 S1994P probably damaging Het
Taok3 T C 5: 117,209,571 I87T probably damaging Het
Tecta T C 9: 42,366,708 Y1168C probably damaging Het
Trhr A G 15: 44,197,627 Y181C probably damaging Het
Ube4b C T 4: 149,383,798 D174N probably damaging Het
Ubr4 C T 4: 139,410,440 H1067Y possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Vmn2r88 T A 14: 51,413,289 L153* probably null Het
Zfp516 T A 18: 82,987,180 D736E probably benign Het
Zfp612 G T 8: 110,089,051 V258F possibly damaging Het
Other mutations in Sobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Sobp APN 10 43022878 missense probably damaging 1.00
IGL02112:Sobp APN 10 43021877 missense probably benign 0.07
R0071:Sobp UTSW 10 43157997 missense probably damaging 1.00
R0071:Sobp UTSW 10 43157997 missense probably damaging 1.00
R0602:Sobp UTSW 10 43022389 missense probably damaging 1.00
R0792:Sobp UTSW 10 43022693 missense probably damaging 0.99
R0847:Sobp UTSW 10 43022419 missense probably damaging 1.00
R0948:Sobp UTSW 10 43022209 missense probably damaging 1.00
R1298:Sobp UTSW 10 43022335 missense probably damaging 1.00
R1484:Sobp UTSW 10 43160831 missense probably damaging 1.00
R1486:Sobp UTSW 10 43022522 missense probably benign 0.42
R1543:Sobp UTSW 10 43021724 missense probably damaging 0.97
R1571:Sobp UTSW 10 43157946 missense possibly damaging 0.93
R1807:Sobp UTSW 10 43160826 missense possibly damaging 0.79
R2198:Sobp UTSW 10 43022524 missense possibly damaging 0.81
R2316:Sobp UTSW 10 43158038 missense possibly damaging 0.75
R4165:Sobp UTSW 10 43021648 missense probably damaging 1.00
R4235:Sobp UTSW 10 43022900 missense probably damaging 1.00
R4587:Sobp UTSW 10 43158024 missense probably damaging 1.00
R5108:Sobp UTSW 10 43160819 missense probably damaging 1.00
R6165:Sobp UTSW 10 43022603 missense probably damaging 1.00
R7069:Sobp UTSW 10 43021440 missense probably benign 0.37
R7346:Sobp UTSW 10 43022835 missense probably damaging 1.00
R7419:Sobp UTSW 10 43021808 missense probably benign 0.00
R7423:Sobp UTSW 10 43022568 nonsense probably null
R7475:Sobp UTSW 10 43021834 missense probably damaging 0.98
R7994:Sobp UTSW 10 43021167 nonsense probably null
R8472:Sobp UTSW 10 43022396 missense probably damaging 0.99
R8558:Sobp UTSW 10 43127892 missense probably damaging 1.00
R8770:Sobp UTSW 10 43160792 missense probably damaging 1.00
R8832:Sobp UTSW 10 43160828 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTGGCACAGGCTGGATC -3'
(R):5'- ACAACGTGATACACCGTGCG -3'

Sequencing Primer
(F):5'- ACAGGCTGGATCACGCAG -3'
(R):5'- CTCACGTCAAGGCGGAG -3'
Posted On2015-07-06