Incidental Mutation 'R4378:Sirt1'
ID325202
Institutional Source Beutler Lab
Gene Symbol Sirt1
Ensembl Gene ENSMUSG00000020063
Gene Namesirtuin 1
SynonymsSir2, Sir2alpha
MMRRC Submission 041121-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4378 (G1)
Quality Score98
Status Not validated
Chromosome10
Chromosomal Location63319005-63381704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 63338949 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 8 (A8T)
Ref Sequence ENSEMBL: ENSMUSP00000101082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020257] [ENSMUST00000105442] [ENSMUST00000120239] [ENSMUST00000146028] [ENSMUST00000177694]
Predicted Effect unknown
Transcript: ENSMUST00000020257
AA Change: A8T
SMART Domains Protein: ENSMUSP00000020257
Gene: ENSMUSG00000020063
AA Change: A8T

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 46 94 N/A INTRINSIC
low complexity region 108 131 N/A INTRINSIC
low complexity region 136 148 N/A INTRINSIC
Pfam:SIR2 253 439 1.3e-62 PFAM
PDB:4KXQ|B 629 648 4e-6 PDB
low complexity region 649 667 N/A INTRINSIC
low complexity region 672 687 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105442
AA Change: A8T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101082
Gene: ENSMUSG00000020063
AA Change: A8T

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 46 94 N/A INTRINSIC
low complexity region 108 131 N/A INTRINSIC
Pfam:SIR2 214 400 4e-63 PFAM
PDB:4KXQ|B 590 609 3e-6 PDB
low complexity region 610 628 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
low complexity region 663 674 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000120239
AA Change: A8T
SMART Domains Protein: ENSMUSP00000112595
Gene: ENSMUSG00000020063
AA Change: A8T

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 46 94 N/A INTRINSIC
low complexity region 108 131 N/A INTRINSIC
low complexity region 136 148 N/A INTRINSIC
Pfam:SIR2 253 439 6.5e-64 PFAM
PDB:4KXQ|B 629 648 4e-6 PDB
low complexity region 649 667 N/A INTRINSIC
low complexity region 672 687 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131371
Predicted Effect probably benign
Transcript: ENSMUST00000146028
SMART Domains Protein: ENSMUSP00000117819
Gene: ENSMUSG00000020063

DomainStartEndE-ValueType
Pfam:SIR2 83 140 1.9e-15 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000177694
AA Change: A8T
SMART Domains Protein: ENSMUSP00000137565
Gene: ENSMUSG00000020063
AA Change: A8T

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 46 94 N/A INTRINSIC
low complexity region 108 131 N/A INTRINSIC
low complexity region 136 148 N/A INTRINSIC
Pfam:SIR2 253 439 7.3e-63 PFAM
low complexity region 465 483 N/A INTRINSIC
low complexity region 488 503 N/A INTRINSIC
low complexity region 518 529 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: This gene encodes a member of the sirtuin family of proteins, characterized by their deacetylase activity and proposed role in longevity. The encoded protein regulates gene expression in a wide range of cell and tissue types through its NAD+-dependent deacetylation of histones, transcription factors and transcriptional coactivators. Brain-specific overexpression of this gene has been shown to result in increased median lifespan. Viability of homozygous knockout mice for this gene varies with strain background. Homozygous knockout mice of strains that do not exhibit embryonic lethality are sterile and have a reduced lifespan. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele show embryonic and fetal lethality, abnormal embryogenesis, and abnormal cellular phenotypes of derived MEFs. Mice homozygous for other knock-out alleles may exhibit peri- and postnatal lethality and heart, mammary gland, eye, and reproductive system anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,293,644 K1836E probably benign Het
Adora1 A G 1: 134,203,210 F241S probably damaging Het
Akt1s1 C T 7: 44,853,960 T168M probably damaging Het
Amigo1 C T 3: 108,191,753 probably benign Het
Amigo2 A G 15: 97,245,978 F188L possibly damaging Het
Armc2 T C 10: 41,993,082 T29A possibly damaging Het
Axl G A 7: 25,758,837 A822V probably benign Het
Borcs5 T C 6: 134,644,329 V21A probably benign Het
Cdc42ep3 A G 17: 79,334,979 S171P probably benign Het
Cmas T C 6: 142,772,285 probably benign Het
Cyp4f40 A G 17: 32,668,029 N158S probably null Het
Dnah6 G T 6: 73,118,026 N2139K probably benign Het
Elmo1 A T 13: 20,373,116 H409L possibly damaging Het
Exoc4 T A 6: 33,815,687 V584E probably damaging Het
Gm7271 A G 5: 76,500,533 K62R probably damaging Het
Gm9116 A G 3: 93,910,479 noncoding transcript Het
Gxylt2 A G 6: 100,733,200 S101G probably benign Het
Hsph1 C A 5: 149,636,007 E24* probably null Het
Ighv1-56 C T 12: 115,242,948 E50K probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrriq1 A T 10: 103,202,364 D859E probably damaging Het
Mapk7 G A 11: 61,493,667 S71L probably damaging Het
Nars A G 18: 64,501,353 Y500H probably damaging Het
Olfr1165-ps G T 2: 88,101,485 N167K unknown Het
Olfr3 T C 2: 36,812,469 M208V probably benign Het
Phc1 T C 6: 122,335,007 N64S possibly damaging Het
Ppp4r3b T A 11: 29,209,450 N180K possibly damaging Het
Primpol G A 8: 46,576,183 probably benign Het
Prtg T C 9: 72,842,760 S149P possibly damaging Het
Qrich2 T C 11: 116,446,915 S1916G probably damaging Het
Rps6ka5 A T 12: 100,597,937 Y218N probably damaging Het
Setbp1 T C 18: 78,856,618 D1278G possibly damaging Het
Sobp C T 10: 43,021,304 V762I probably damaging Het
Sptan1 T C 2: 30,025,569 S1994P probably damaging Het
Taok3 T C 5: 117,209,571 I87T probably damaging Het
Tecta T C 9: 42,366,708 Y1168C probably damaging Het
Trhr A G 15: 44,197,627 Y181C probably damaging Het
Ube4b C T 4: 149,383,798 D174N probably damaging Het
Ubr4 C T 4: 139,410,440 H1067Y possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Vmn2r88 T A 14: 51,413,289 L153* probably null Het
Zfp516 T A 18: 82,987,180 D736E probably benign Het
Zfp612 G T 8: 110,089,051 V258F possibly damaging Het
Other mutations in Sirt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02057:Sirt1 APN 10 63325203 missense probably damaging 1.00
IGL02106:Sirt1 APN 10 63335829 missense probably damaging 1.00
PIT4283001:Sirt1 UTSW 10 63321786 missense probably benign 0.02
R0658:Sirt1 UTSW 10 63321736 unclassified probably benign
R0724:Sirt1 UTSW 10 63323973 missense possibly damaging 0.82
R1653:Sirt1 UTSW 10 63321809 missense probably benign
R1831:Sirt1 UTSW 10 63320646 missense probably benign 0.13
R4133:Sirt1 UTSW 10 63335659 missense probably null 0.42
R4250:Sirt1 UTSW 10 63337098 critical splice acceptor site probably null
R4396:Sirt1 UTSW 10 63321998 missense probably benign 0.00
R4776:Sirt1 UTSW 10 63335722 missense probably benign 0.17
R4898:Sirt1 UTSW 10 63322004 missense probably benign 0.35
R7151:Sirt1 UTSW 10 63323996 missense probably damaging 1.00
R7365:Sirt1 UTSW 10 63322003 missense probably benign
R7467:Sirt1 UTSW 10 63322150 missense probably benign 0.00
R7773:Sirt1 UTSW 10 63326783 missense possibly damaging 0.75
R8729:Sirt1 UTSW 10 63320926 missense probably damaging 1.00
R8949:Sirt1 UTSW 10 63326185 missense probably damaging 1.00
RF015:Sirt1 UTSW 10 63337016 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGTCGTCGAAGTCGTCAG -3'
(R):5'- GAGCCCCTGAGGTAAAAGC -3'

Sequencing Primer
(F):5'- AGGCCGGACCCATTGTCTC -3'
(R):5'- CCCTGAGGTAAAAGCCGACTTG -3'
Posted On2015-07-06