Incidental Mutation 'R4378:Vmn2r88'
ID325212
Institutional Source Beutler Lab
Gene Symbol Vmn2r88
Ensembl Gene ENSMUSG00000000606
Gene Namevomeronasal 2, receptor 88
SynonymsV2r3, V2r13
MMRRC Submission 041121-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R4378 (G1)
Quality Score107
Status Validated
Chromosome14
Chromosomal Location51410819-51419527 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 51413289 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 153 (L153*)
Ref Sequence ENSEMBL: ENSMUSP00000154310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022438] [ENSMUST00000159674] [ENSMUST00000162998] [ENSMUST00000228139]
Predicted Effect probably null
Transcript: ENSMUST00000022438
AA Change: L153*
SMART Domains Protein: ENSMUSP00000022438
Gene: ENSMUSG00000000606
AA Change: L153*

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 457 8.3e-27 PFAM
Pfam:NCD3G 516 570 1.2e-18 PFAM
Pfam:7tm_3 603 838 1.9e-55 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159674
AA Change: L153*
SMART Domains Protein: ENSMUSP00000125126
Gene: ENSMUSG00000000606
AA Change: L153*

DomainStartEndE-ValueType
Pfam:ANF_receptor 30 408 3.2e-30 PFAM
Pfam:NCD3G 463 516 1.2e-19 PFAM
Pfam:7tm_3 546 785 3.7e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161565
Predicted Effect probably benign
Transcript: ENSMUST00000162998
SMART Domains Protein: ENSMUSP00000125409
Gene: ENSMUSG00000068399

DomainStartEndE-ValueType
Pfam:Takusan 35 115 2.2e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163019
AA Change: L128*
SMART Domains Protein: ENSMUSP00000124837
Gene: ENSMUSG00000000606
AA Change: L128*

DomainStartEndE-ValueType
Pfam:ANF_receptor 52 399 3.7e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000228139
AA Change: L153*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,293,644 K1836E probably benign Het
Adora1 A G 1: 134,203,210 F241S probably damaging Het
Akt1s1 C T 7: 44,853,960 T168M probably damaging Het
Amigo1 C T 3: 108,191,753 probably benign Het
Amigo2 A G 15: 97,245,978 F188L possibly damaging Het
Armc2 T C 10: 41,993,082 T29A possibly damaging Het
Axl G A 7: 25,758,837 A822V probably benign Het
Borcs5 T C 6: 134,644,329 V21A probably benign Het
Cdc42ep3 A G 17: 79,334,979 S171P probably benign Het
Cmas T C 6: 142,772,285 probably benign Het
Cyp4f40 A G 17: 32,668,029 N158S probably null Het
Dnah6 G T 6: 73,118,026 N2139K probably benign Het
Elmo1 A T 13: 20,373,116 H409L possibly damaging Het
Exoc4 T A 6: 33,815,687 V584E probably damaging Het
Gm7271 A G 5: 76,500,533 K62R probably damaging Het
Gm9116 A G 3: 93,910,479 noncoding transcript Het
Gxylt2 A G 6: 100,733,200 S101G probably benign Het
Hsph1 C A 5: 149,636,007 E24* probably null Het
Ighv1-56 C T 12: 115,242,948 E50K probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrriq1 A T 10: 103,202,364 D859E probably damaging Het
Mapk7 G A 11: 61,493,667 S71L probably damaging Het
Nars A G 18: 64,501,353 Y500H probably damaging Het
Olfr1165-ps G T 2: 88,101,485 N167K unknown Het
Olfr3 T C 2: 36,812,469 M208V probably benign Het
Phc1 T C 6: 122,335,007 N64S possibly damaging Het
Ppp4r3b T A 11: 29,209,450 N180K possibly damaging Het
Primpol G A 8: 46,576,183 probably benign Het
Prtg T C 9: 72,842,760 S149P possibly damaging Het
Qrich2 T C 11: 116,446,915 S1916G probably damaging Het
Rps6ka5 A T 12: 100,597,937 Y218N probably damaging Het
Setbp1 T C 18: 78,856,618 D1278G possibly damaging Het
Sirt1 C T 10: 63,338,949 A8T probably benign Het
Sobp C T 10: 43,021,304 V762I probably damaging Het
Sptan1 T C 2: 30,025,569 S1994P probably damaging Het
Taok3 T C 5: 117,209,571 I87T probably damaging Het
Tecta T C 9: 42,366,708 Y1168C probably damaging Het
Trhr A G 15: 44,197,627 Y181C probably damaging Het
Ube4b C T 4: 149,383,798 D174N probably damaging Het
Ubr4 C T 4: 139,410,440 H1067Y possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Zfp516 T A 18: 82,987,180 D736E probably benign Het
Zfp612 G T 8: 110,089,051 V258F possibly damaging Het
Other mutations in Vmn2r88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r88 APN 14 51413125 missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51413060 missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51413256 missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51416802 missense possibly damaging 0.59
IGL02308:Vmn2r88 APN 14 51417980 missense possibly damaging 0.96
IGL02481:Vmn2r88 APN 14 51414154 missense probably benign
IGL02483:Vmn2r88 APN 14 51414154 missense probably benign
IGL03241:Vmn2r88 APN 14 51418373 missense probably benign 0.03
R0052:Vmn2r88 UTSW 14 51418700 missense possibly damaging 0.88
R0070:Vmn2r88 UTSW 14 51414140 missense probably benign 0.08
R0799:Vmn2r88 UTSW 14 51414502 missense possibly damaging 0.61
R0906:Vmn2r88 UTSW 14 51418209 missense probably damaging 1.00
R1322:Vmn2r88 UTSW 14 51414108 missense probably damaging 1.00
R1352:Vmn2r88 UTSW 14 51418550 missense probably damaging 1.00
R1639:Vmn2r88 UTSW 14 51416787 missense probably damaging 0.98
R1780:Vmn2r88 UTSW 14 51418572 missense probably damaging 1.00
R1834:Vmn2r88 UTSW 14 51413030 splice site probably benign
R1911:Vmn2r88 UTSW 14 51418214 missense probably damaging 1.00
R2113:Vmn2r88 UTSW 14 51418194 missense probably damaging 1.00
R2120:Vmn2r88 UTSW 14 51413208 missense probably benign 0.00
R2126:Vmn2r88 UTSW 14 51413807 missense probably benign 0.01
R2348:Vmn2r88 UTSW 14 51414004 missense probably benign 0.00
R2881:Vmn2r88 UTSW 14 51418689 missense probably damaging 0.97
R2884:Vmn2r88 UTSW 14 51413934 missense probably damaging 1.00
R3081:Vmn2r88 UTSW 14 51418632 missense probably damaging 0.99
R3933:Vmn2r88 UTSW 14 51413978 missense probably benign 0.44
R3967:Vmn2r88 UTSW 14 51413190 missense probably benign 0.06
R4091:Vmn2r88 UTSW 14 51415426 missense probably damaging 1.00
R4397:Vmn2r88 UTSW 14 51417978 missense probably damaging 1.00
R4418:Vmn2r88 UTSW 14 51418081 missense probably damaging 1.00
R4609:Vmn2r88 UTSW 14 51418074 missense probably damaging 0.98
R4647:Vmn2r88 UTSW 14 51418793 missense probably benign 0.02
R4672:Vmn2r88 UTSW 14 51418155 missense probably damaging 1.00
R4684:Vmn2r88 UTSW 14 51413334 missense possibly damaging 0.95
R4686:Vmn2r88 UTSW 14 51413339 missense probably benign 0.03
R4720:Vmn2r88 UTSW 14 51413245 missense probably benign 0.01
R5046:Vmn2r88 UTSW 14 51413181 missense probably benign 0.03
R5063:Vmn2r88 UTSW 14 51411146 missense probably damaging 0.96
R5619:Vmn2r88 UTSW 14 51413910 missense probably damaging 0.99
R5652:Vmn2r88 UTSW 14 51418572 missense probably damaging 0.98
R6020:Vmn2r88 UTSW 14 51418149 nonsense probably null
R6103:Vmn2r88 UTSW 14 51415369 missense probably benign 0.17
R6674:Vmn2r88 UTSW 14 51414338 missense probably benign 0.01
R6799:Vmn2r88 UTSW 14 51413969 missense probably benign 0.05
R7089:Vmn2r88 UTSW 14 51418643 missense
R7104:Vmn2r88 UTSW 14 51413796 missense
R7265:Vmn2r88 UTSW 14 51418319 missense
R7316:Vmn2r88 UTSW 14 51414255 missense
R7552:Vmn2r88 UTSW 14 51410858 intron probably null
R7611:Vmn2r88 UTSW 14 51413997 missense
R7667:Vmn2r88 UTSW 14 51417989 missense
R7682:Vmn2r88 UTSW 14 51418449 missense
R7755:Vmn2r88 UTSW 14 51413046 missense probably benign 0.00
R7811:Vmn2r88 UTSW 14 51418703 missense
R7998:Vmn2r88 UTSW 14 51414108 missense
V5622:Vmn2r88 UTSW 14 51413127 missense probably benign
X0024:Vmn2r88 UTSW 14 51413832 missense possibly damaging 0.79
X0025:Vmn2r88 UTSW 14 51416802 missense possibly damaging 0.59
Z1177:Vmn2r88 UTSW 14 51418046 frame shift probably null
Z1177:Vmn2r88 UTSW 14 51418187 missense
Predicted Primers PCR Primer
(F):5'- ACCCAACATAACTTTGATGTTCTCC -3'
(R):5'- CTAGAACACAGTTTTACCTGTTTGC -3'

Sequencing Primer
(F):5'- CCATCATTGGTGGAAACTGTC -3'
(R):5'- CCTGTTTGCAGTGTACATCTACGAAG -3'
Posted On2015-07-06