Incidental Mutation 'R4378:Trhr'
ID325213
Institutional Source Beutler Lab
Gene Symbol Trhr
Ensembl Gene ENSMUSG00000038760
Gene Namethyrotropin releasing hormone receptor
SynonymsTRH-R1
MMRRC Submission 041121-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4378 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location44196135-44235912 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44197627 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 181 (Y181C)
Ref Sequence ENSEMBL: ENSMUSP00000154650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038856] [ENSMUST00000110289] [ENSMUST00000226626] [ENSMUST00000227505]
Predicted Effect probably damaging
Transcript: ENSMUST00000038856
AA Change: Y181C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000036320
Gene: ENSMUSG00000038760
AA Change: Y181C

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 33 177 1.6e-7 PFAM
Pfam:7TM_GPCR_Srsx 36 335 4.8e-12 PFAM
Pfam:7tm_1 42 320 1.6e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110289
AA Change: Y181C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105918
Gene: ENSMUSG00000038760
AA Change: Y181C

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 33 175 1.9e-7 PFAM
Pfam:7TM_GPCR_Srsx 36 335 4.8e-12 PFAM
Pfam:7tm_1 42 320 1.3e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226626
AA Change: Y181C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000227505
Meta Mutation Damage Score 0.8852 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor for thyrotropin-releasing hormone (TRH). Upon binding to TRH, this receptor activates the inositol phospholipid-calcium-protein kinase C transduction pathway. Mutations in this gene have been associated with generalized thyrotropin-releasing hormone resistance. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice are fertile and display decreased thyroxine, triiodothyronine, and prolactin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,293,644 K1836E probably benign Het
Adora1 A G 1: 134,203,210 F241S probably damaging Het
Akt1s1 C T 7: 44,853,960 T168M probably damaging Het
Amigo1 C T 3: 108,191,753 probably benign Het
Amigo2 A G 15: 97,245,978 F188L possibly damaging Het
Armc2 T C 10: 41,993,082 T29A possibly damaging Het
Axl G A 7: 25,758,837 A822V probably benign Het
Borcs5 T C 6: 134,644,329 V21A probably benign Het
Cdc42ep3 A G 17: 79,334,979 S171P probably benign Het
Cmas T C 6: 142,772,285 probably benign Het
Cyp4f40 A G 17: 32,668,029 N158S probably null Het
Dnah6 G T 6: 73,118,026 N2139K probably benign Het
Elmo1 A T 13: 20,373,116 H409L possibly damaging Het
Exoc4 T A 6: 33,815,687 V584E probably damaging Het
Gm7271 A G 5: 76,500,533 K62R probably damaging Het
Gm9116 A G 3: 93,910,479 noncoding transcript Het
Gxylt2 A G 6: 100,733,200 S101G probably benign Het
Hsph1 C A 5: 149,636,007 E24* probably null Het
Ighv1-56 C T 12: 115,242,948 E50K probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrriq1 A T 10: 103,202,364 D859E probably damaging Het
Mapk7 G A 11: 61,493,667 S71L probably damaging Het
Nars A G 18: 64,501,353 Y500H probably damaging Het
Olfr1165-ps G T 2: 88,101,485 N167K unknown Het
Olfr3 T C 2: 36,812,469 M208V probably benign Het
Phc1 T C 6: 122,335,007 N64S possibly damaging Het
Ppp4r3b T A 11: 29,209,450 N180K possibly damaging Het
Primpol G A 8: 46,576,183 probably benign Het
Prtg T C 9: 72,842,760 S149P possibly damaging Het
Qrich2 T C 11: 116,446,915 S1916G probably damaging Het
Rps6ka5 A T 12: 100,597,937 Y218N probably damaging Het
Setbp1 T C 18: 78,856,618 D1278G possibly damaging Het
Sirt1 C T 10: 63,338,949 A8T probably benign Het
Sobp C T 10: 43,021,304 V762I probably damaging Het
Sptan1 T C 2: 30,025,569 S1994P probably damaging Het
Taok3 T C 5: 117,209,571 I87T probably damaging Het
Tecta T C 9: 42,366,708 Y1168C probably damaging Het
Ube4b C T 4: 149,383,798 D174N probably damaging Het
Ubr4 C T 4: 139,410,440 H1067Y possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Vmn2r88 T A 14: 51,413,289 L153* probably null Het
Zfp516 T A 18: 82,987,180 D736E probably benign Het
Zfp612 G T 8: 110,089,051 V258F possibly damaging Het
Other mutations in Trhr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01596:Trhr APN 15 44229312 missense probably damaging 1.00
IGL01800:Trhr APN 15 44229207 missense possibly damaging 0.69
IGL01945:Trhr APN 15 44197144 missense probably damaging 0.99
IGL02608:Trhr APN 15 44197678 missense probably benign 0.08
IGL02825:Trhr APN 15 44229525 missense possibly damaging 0.62
pushover UTSW 15 44197627 missense probably damaging 1.00
P4717OSA:Trhr UTSW 15 44197435 missense probably damaging 0.97
R0007:Trhr UTSW 15 44229151 splice site probably benign
R0276:Trhr UTSW 15 44197086 start codon destroyed probably null 0.74
R0620:Trhr UTSW 15 44229500 missense probably benign 0.01
R1563:Trhr UTSW 15 44197101 missense probably benign 0.05
R1728:Trhr UTSW 15 44197153 missense probably damaging 1.00
R1729:Trhr UTSW 15 44197153 missense probably damaging 1.00
R2144:Trhr UTSW 15 44197183 missense probably benign 0.44
R2167:Trhr UTSW 15 44229242 missense probably damaging 1.00
R3965:Trhr UTSW 15 44197699 missense possibly damaging 0.70
R4246:Trhr UTSW 15 44233460 critical splice acceptor site probably null
R4272:Trhr UTSW 15 44197224 missense probably damaging 0.97
R4618:Trhr UTSW 15 44197641 missense probably benign 0.00
R5093:Trhr UTSW 15 44197584 missense probably damaging 0.96
R5388:Trhr UTSW 15 44197477 missense possibly damaging 0.91
R5496:Trhr UTSW 15 44197536 missense probably benign 0.00
R6341:Trhr UTSW 15 44229298 nonsense probably null
R6463:Trhr UTSW 15 44197585 missense probably benign 0.09
R6575:Trhr UTSW 15 44229206 missense possibly damaging 0.83
R7483:Trhr UTSW 15 44229231 missense probably damaging 1.00
Y5406:Trhr UTSW 15 44197641 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGTACATAGCAATCTGTCACCC -3'
(R):5'- CCTGGAAGATACAGTGCTGTTG -3'

Sequencing Primer
(F):5'- CCATCAAAGCCCAGTTTCTCTG -3'
(R):5'- CTGATGGATTGAGTCATTTTTCCAC -3'
Posted On2015-07-06